RegulonDB RegulonDB 10.9: Gene Sequence
ykfN gene sequence


Size: 63        A: 22  T: 20  G: 12  C: 9

Fasta

 

>ykfN E. coli K12. Version NC_000913.3 GI:556503834
atgcaaccagaagttgaagtattaaccgatcataatgagctaatttgttcgagctttatt
gaa
              
                            

Download fasta file
RegulonDB