RegulonDB RegulonDB 10.9: Gene Sequence
oweE gene sequence


Size: 234        A: 55  T: 52  G: 75  C: 52

Fasta

 

>oweE E. coli K12. Version NC_000913.3 GI:556503834
atgagcactaaattaaccggctatgtatgggatggttgcgctgcatcaggcatgaagtta
tccagcgtggcaattatggcccgcctggctgatttcagtaatgacgaaggtgtgtgctgg
ccatcaattgaaaccattgcccgtcagattggcgcggggatgagtaccgtcagaacggct
atcgcacggctggaagcagaaggctggttaacgcgtaaggcgcgtcgccagggt
              
                            

Download fasta file
RegulonDB