RegulonDB RegulonDB 10.9: Gene Sequence
ylbI gene sequence


Size: 96        A: 21  T: 14  G: 33  C: 28

Fasta

 

>ylbI E. coli K12. Version NC_000913.3 GI:556503834
attagcggaaaaccagcggcacgccagggtgacatgccccagtacggcggcccgatagtc
cagggttcagcgggggtactgatagtcgcgccgact
              
                            

Download fasta file
RegulonDB