RegulonDB RegulonDB 10.9: Gene Sequence
ynaM gene sequence


Size: 114        A: 41  T: 34  G: 15  C: 24

Fasta

 

>ynaM E. coli K12. Version NC_000913.3 GI:556503834
atgaacagcatactgataatcacttcgctccttatcatattcagcatttttagtcatgct
ctaataaaattagggattggcatatccaataacccagacaaaaccgatgtataa
              
                            

Download fasta file
RegulonDB