RegulonDB RegulonDB 10.9: Gene Sequence
yacM gene sequence


Size: 45        A: 21  T: 10  G: 9  C: 5

Fasta

 

>yacM E. coli K12. Version NC_000913.3 GI:556503834
atgattatcaaaacgttaaaaatgagtgcacgaaagcgaaattga
              
                            

Download fasta file
RegulonDB