RegulonDB RegulonDB 10.8: Gene Sequence
ymgM gene sequence


Size: 204        A: 52  T: 48  G: 37  C: 67

Fasta

 

>ymgM E. coli K12. Version NC_000913.3 GI:556503834
atggacgacaaacaattgcaggctcaggctgcgttcagcaaagcatcgcaaccggcgata
gatgcttcattaaatttaagattcagcttcctcttcagccacccgtacgccaatcttcaa
cacttcattatcttctttctcggccaccgtccagatcatcccggcaaactctacctggtc
accgacaaccggtgccgcgcctaa
              
                            

Download fasta file
RegulonDB