RegulonDB RegulonDB 10.9: Gene Sequence
yoaL gene sequence


Size: 159        A: 30  T: 55  G: 32  C: 42

Fasta

 

>yoaL E. coli K12. Version NC_000913.3 GI:556503834
atggatcgtcaccgacgtcatttcagcatcaggccttttaacgcctgcctttctggcact
ctatgccgcacctttcgtttgcattttgtcgttacgcctgcattatttctggcgtcgaat
agctattccttaagcaggagcttgtcatggaattcttaa
              
                            

Download fasta file
RegulonDB