RegulonDB RegulonDB 10.9: Gene Sequence
yncO gene sequence


Size: 186        A: 48  T: 79  G: 18  C: 41

Fasta

 

>yncO E. coli K12. Version NC_000913.3 GI:556503834
gtgatttacatcacaattttcatgatcttgccctgccccgtcccttgctctcatgtcttt
ctgtatgtattttatatttttctctttctggtgttgttcattatgaccatttaccaatcc
agtcaaaaacttcatttttcaaattgttatcataataatcaacatcataatagtctccat
aattaa
              
                            

Download fasta file
RegulonDB