RegulonDB RegulonDB 10.10: Gene Sequence
ymiC gene sequence


Size: 96        A: 22  T: 30  G: 21  C: 23

Fasta

 

>ymiC E. coli K12. Version NC_000913.3 GI:556503834
atgatcaacacaaatatgaaatattggtcctggatgggcgcgttttctctgtcgatgctc
ttctgggccgaactcctctggatcattactcactga
              
                            

Download fasta file
RegulonDB