RegulonDB RegulonDB 10.9: Gene Sequence
yecU gene sequence


Size: 177        A: 61  T: 55  G: 25  C: 36

Fasta

 

>yecU E. coli K12. Version NC_000913.3 GI:556503834
atgataaaaatatttattggtcattatattaacgtattttatagcactgccgatatcacg
ctcaaaaaacaaccactgctatttttagcaaagcttatggtatactccgccgccttaaca
tttttcaccgcaaattttcattgcaacatgacgaggaaaataaatgagtacgcctga
              
                            

Download fasta file
RegulonDB