RegulonDB RegulonDB 10.9: Gene Sequence
yddY gene sequence


Size: 42        A: 7  T: 16  G: 11  C: 8

Fasta

 

>yddY E. coli K12. Version NC_000913.3 GI:556503834
atggtgcagttagtcgatctcgcacgttgcgtttcattttga
              
                            

Download fasta file
RegulonDB