RegulonDB RegulonDB 10.8: Gene Sequence
ymjE gene sequence


Size: 165        A: 36  T: 40  G: 41  C: 48

Fasta

 

>ymjE E. coli K12. Version NC_000913.3 GI:556503834
atgccgatgattaaatccccgcatggcgagggaggctgcgtatgcgcccctcctgctact
gactggactccgccccctttgcttcccttgctaaacaggtttgatttcaggtcgacacga
ccgcaaaccttattacgcaggggaggcagcaattatggctattaa
              
                            

Download fasta file
RegulonDB