RegulonDB RegulonDB 10.10: Gene Sequence
yabR gene sequence


Size: 45        A: 21  T: 10  G: 8  C: 6

Fasta

 

>yabR E. coli K12. Version NC_000913.3 GI:556503834
gtgaaaagaaacgataaaatcctccattacagaggattaaattga
              
                            

Download fasta file
RegulonDB