RegulonDB RegulonDB 10.9: Gene Sequence
yliM gene sequence


Size: 66        A: 22  T: 17  G: 13  C: 14

Fasta

 

>yliM E. coli K12. Version NC_000913.3 GI:556503834
atggaaacgttctgttacatgaaatggcccgttagacatcacaaatcgcgaagagtttcc
cattaa
              
                            

Download fasta file
RegulonDB