RegulonDB RegulonDB 10.9: Gene Sequence
ynfS gene sequence


Size: 90        A: 24  T: 32  G: 18  C: 16

Fasta

 

>ynfS E. coli K12. Version NC_000913.3 GI:556503834
atgaataaccccgtctgtcttgatgactggttgattggctttaaaagcttatgctgtact
ttggccgtaatagctctgctaataatataa
              
                            

Download fasta file
RegulonDB