RegulonDB RegulonDB 10.9: Gene Sequence
argL gene sequence


Size: 96        A: 38  T: 29  G: 15  C: 14

Fasta

 

>argL E. coli K12. Version NC_000913.3 GI:556503834
atgaataattacacatataaagtgaattttaattcaataagtggcgttcgccatgcgagg
ataaaatgtccgatttatacaaaaaacactttctga
              
                            

Download fasta file
RegulonDB