RegulonDB RegulonDB 10.9: Gene Sequence
yncP gene sequence


Size: 69        A: 16  T: 14  G: 19  C: 20

Fasta

 

>yncP E. coli K12. Version NC_000913.3 GI:556503834
atgaatctgctagtcaaatgcgcggggaaaatccccgcgcttgcccttacctggacgtgc
aggccatga
              
                            

Download fasta file
RegulonDB