RegulonDB RegulonDB 11.0: Gene Sequence
yqgG gene sequence


Size: 144        A: 26  T: 46  G: 30  C: 42

Fasta

 

>yqgG E. coli K12. Version NC_000913.3 GI:556503834
atgaaccgttgtctgctgcttaacctgtctcaccgttctggtgaagattcgttccccgca
ctctgcatctctgctttgcatacctgccgatgttatacccatctcggcgcttctcaggat
tcaagagctggttacagttactga
              
                            

Download fasta file
RegulonDB