RegulonDB RegulonDB 10.9: Gene Sequence
evgL gene sequence


Size: 30        A: 11  T: 9  G: 6  C: 4

Fasta

 

>evgL E. coli K12. Version NC_000913.3 GI:556503834
atgcttcattgcaaagggaataatctatga
              
                            

Download fasta file
RegulonDB