RegulonDB RegulonDB 11.0: Gene Sequence
yecV gene sequence


Size: 45        A: 18  T: 13  G: 7  C: 7

Fasta

 

>yecV E. coli K12. Version NC_000913.3 GI:556503834
atgtccattttcagaatacatttagatggcaataaaaaagcctga
              
                            

Download fasta file
RegulonDB