RegulonDB RegulonDB 10.9: Gene Sequence
mgtT gene sequence


Size: 105        A: 31  T: 22  G: 26  C: 26

Fasta

 

>mgtT E. coli K12. Version NC_000913.3 GI:556503834
atgaacggagataatccctcacctaaccggccccttgttacagttgtgtacaaggggcct
gatttttatgacggcgaaaaaaaaccgccagtaaaccggcggtga
              
                            

Download fasta file
RegulonDB