RegulonDB RegulonDB 10.9: Gene Sequence
pssL gene sequence


Size: 42        A: 18  T: 11  G: 9  C: 4

Fasta

 

>pssL E. coli K12. Version NC_000913.3 GI:556503834
atgaacagagaagaaatgcactgtgatgttgtcaaaatttaa
              
                            

Download fasta file
RegulonDB