RegulonDB RegulonDB 10.9: Gene Sequence
yfiS gene sequence


Size: 63        A: 16  T: 16  G: 23  C: 8

Fasta

 

>yfiS E. coli K12. Version NC_000913.3 GI:556503834
atggaagtgggcaagttggggaagccgtatccgttgctgaatctggcatatgtgggagta
taa
              
                            

Download fasta file
RegulonDB