RegulonDB RegulonDB 10.9: Amino acid Sequence
glucose-specific PTS enzyme IIBC component Amino Acid Sequence


Size: 477

Fasta

 

>YnfM3' E. coli K12. Version NC_000913.3 GI:556503834
UGUUUAAGAAUGCAUUUGCUAACCUGCAAAAGGUCGGUAAAUCGCUGAUGCUGCCGGUAU
CCGUACUGCCUAUCGCAGGUAUUCUGCUGGGCGUCGGUUCCGCGAAUUUCAGCUGGCUGC
CCGCCGUUGUAUCGCAUGUUAUGGCAGAAGCAGGCGGUUCCGUCUUUGCAAACAUGCCAC
UGAUUUUUGCGAUCGGUGUCGCCCUCGGCUUUACCAAUAACGAUGGCGUAUCCGCGCUGG
CCGCAGUUGUUGCCUAUGGCAUCAUGGUUAAAACCAUGGCCGUGGUUGCGCCACUGGUAC
UGCAUUUACCUGCUGAAGAAAUCGCCUCUAAACACCUGGCGGAUACUGGCGUACUCGGAG
GGAUUAUCUCCGGUGCGAUCGCAGCGUACAUGUUUAACCGUUUCUACCGUAUUAAGCUGC
CUGAGUAUCUUGGCUUCUUUGCCGGUAAACGCUUUGUGCCGAUCAUUUCUGGCCUGGCUG
CCAUCUUUACUGGCGUUGUGCUGUCCUUCAUUUGGCCGCCGAUUGGUUCUGCAAUCCAGA
CCUUCUCUCAGUGGGCUGCUUACCAGAACCCGGUAGUUGCGUUUGGCAUUUACGGUUUCA
UCGAACGUUGCCUGGUACCGUUUGGUCUGCACCACAUCUGGAACGUACCUUUCCAGAUGC
AGAUUGGUGAAUACACCAACGCAGCAGGUCAGGUUUUCCACGGCGACAUUCCGCGUUAUA
UGGCGGGUGACCCGACUGCGGGUAAACUGUCUGGUGGCUUCCUGUUCAAAAUGUACGGUC
UGCCAGCUGCCGCAAUUGCUAUCUGGCACUCUGCUAAACCAGAAAACCGCGCGAAAGUGG
GCGGUAUUAUGAUCUCCGCGGCGCUGACCUCGUUCCUGACCGGUAUCACCGAGCCGAUCG
AGUUCUCCUUCAUGUUCGUUGCGCCGAUCCUGUACAUCAUCCACGCGAUUCUGGCAGGCC
UGGCAUUCCCAAUCUGUAUUCUUCUGGGGAUGCGUGACGGUACGUCGUUCUCGCACGGUC
UGAUCGACUUCAUCGUUCUGUCUGGUAACAGCAGCAAACUGUGGCUGUUCCCGAUCGUCG
GUAUCGGUUAUGCGAUUGUUUACUACACCAUCUUCCGCGUGCUGAUUAAAGCACUGGAUC
UGAAAACGCCGGGUCGUGAAGACGCGACUGAAGAUGCAAAAGCGACAGGUACCAGCGAAA
UGGCACCGGCUCUGGUUGCUGCAUUUGGUGGUAAAGAAAACAUUACUAACCUCGACGCAU
GUAUUACCCGUCUGCGCGUCAGCGUUGCUGAUGUGUCUAAAGUGGAUCAGGCCGGCCUGA
AGAAACUGGGCGCAGCGGGCGUAGUGGUUGCUGGUUCUGGUGUUCAGGCGAUUUUCGGUA
CUAAAUCCGAUAACCUGAAAACCGAGAUGGAUGAGUACAUCCGUAACCACUAA
              
                            

Download fasta file
RegulonDB