RegulonDB RegulonDB 10.8: smallRNA Sequence
GcvB small RNA sequence


Size: 204        A: 38  U: 78  G: 48  C: 40

Fasta

 

>GcvB E. coli K12. Version NC_000913.3 GI:556503834
ACUUCCUGAGCCGGAACGAAAAGUUUUAUCGGAAUGCGUGUUCUGGUGAACUUUUGGCUU
ACGGUUGUGAUGUUGUGUUGUUGUGUUUGCAAUUGGUCUGCGAUUCAGACCAUGGUAGCA
AAGCUACCUUUUUUCACUUCCUGUACAUUUACCCUGUCUGUCCAUAGUGAUUAAUGUAGC
ACCGCCUAAUUGCGGUGCUUUUUUU
          
                        

Download fasta file
RegulonDB