RegulonDB RegulonDB 10.9: smallRNA Sequence
small regulatory RNA RybB small RNA sequence


Size: 79        A: 11  U: 30  G: 17  C: 21

Fasta

 

>RybB E. coli K12. Version NC_000913.3 GI:556503834
GCCACUGCUUUUCUUUGAUGUCCCCAUUUUGUGGAGCCCAUCAACCCCGCCAUUUCGGUU
CAAGGUUGAUGGGUUUUUUG
          
                        

Download fasta file
RegulonDB