RegulonDB RegulonDB 10.9: smallRNA Sequence
small regulatory RNA SdsR small RNA sequence


Size: 104        A: 24  U: 28  G: 22  C: 30

Fasta

 

>RyeB E. coli K12. Version NC_000913.3 GI:556503834
GGCAAGGCAACUAAGCCUGCAUUAAUGCCAACUUUUAGCGCACGGCUCUCUCCCAAGAGC
CAUUUCCCUGGACCGAAUACAGGAAUCGUGUUCGGUCUCUUUU
          
                        

Download fasta file
RegulonDB