RegulonDB RegulonDB 10.9: smallRNA Form
   

small regulatory RNA Spot 42 small RNA in Escherichia coli K-12 genome


Gene local context to scale (view description)

polA yihA spf CRP spfp spfp TSS_4538 TSS_4538 TSS_4537 TSS_4537 TSS_4536 TSS_4536 TSS_4535 TSS_4535 TSS_4534 TSS_4534
small RNA      
Gene name: spf    Texpresso search in the literature
Synonym(s): IS197, Spf, Spf RNA
Genome position: 4049899 --> 4050009
Strand: forward
Sequence: Get ribonucleotide sequence FastaFormat
GC content %:  
41.44
Note(s): The small regulatory RNA Spot 42 (Spf) was first identified as an abundant, non-translated RNA in E. coli 4577761. 4577762. 390161. 229230. 2440852. Its first regulatory target, galK, was identified much later Moller T,2002. Urban JH,2007. Wang X,2015, and additional regulatory targets were identified by Beisel CL,2011. Beisel CL,2012. Wright PR,2013. Chen J,2017. Three conserved unstructured regions of Spot 42 are able to basepair with different mRNA targets Beisel CL,2012.
Spot 42 was initially thought to be responsible for selective inhibition of translation of galK within the gal operon mRNA by occluding interaction of the ribosome with the galK Shine-Dalgarno sequence Moller T,2002. Later, it was shown that Spot 42 regulation of galK expression by Spot 42 at this site occurs after RNase cleavage of mRNAs transcribed from the galE promoter, which generates the so-called mK2 mRNA with a new 5' end Wang X,2014. Binding of Spot 42 leads to degradation of mK2 Wang X,2015. Spot 42 also affects polarity of gene expression; its binding site overlaps with a putative |FRAME: CPLX0-2441 Rho|-binding site and may enhance Rho-mediated transcription termination Wang X,2015.
Spot 42 does not inhibit translation of the sdhCDAB operon directly. Instead, Spot 42 binds upstream of the translation initiation site and recruits Hfq to its binding site, which occludes the site for binding of the 30S subunit of the ribosome Desnoyers G,2012. Spot 42 downregulates expression of the high-affinity arabinose transporter at low inducer (arabinose) concentration, and thereby indirectly regulates expression from the pBAD promoter Chen J,2017.
An spf deletion mutant exhibits a mild growth defect in some, but not all, strain backgrounds 2940230. Overexpression of Spf RNA results in slow growth, particularly on succinate 6183252 as well as other carbon sources Beisel CL,2011, and a pronounced growth defect upon transfer from minimal to rich media, compared to wild type 6183252. Overexpression also leads to a two-fold increase in 6S RNA abundance 6183252 and increased DNA polymerase I activity 2452153.
Transcription of spf is negatively regulated by cAMP-CRP Polayes DA,1988 and is highest during early exponential phase Wang X,2015. Spot 42 and CRP form a multi-output feedforward loop during catabolite repression. Both the steady-state level and dynamics of gene regulation are affected Beisel CL,2011. 21788732. Spot 42 RNA accumulates to 150-200 copies per cell in glucose-grown cells 229230. The Hfq protein stabilizes Spot 42 and stimulates pairing of Spf regions with complementary RNA sequences Moller T,2002. Spot 42 appears to be unable to compete effectively for Hfq binding Moon K,2011. The small RNA PspH is able to base-pair with Spot 42; overexpression of PspH leads to an almost 5-fold reduction in the level of Spot 42 Melamed S,2016.
Spf: spot fourty-two
Reviews: 2450678. 10068996. 12732300. 15063850. 15487940. 17381274. 18981470. 19239884. 21292156. 21843668. 26327359. 32213244
Evidence: [IMP] Inferred from mutant phenotype
[IPI] Inferred from physical interaction
Reference(s): [1] Chen S., et al., 2002
[2] Joyce CM., et al., 1982
[3] Komine Y., et al., 1991
[4] Mihailovic MK., et al., 2018
[5] Moller T., et al., 2002
[6] Wang X., et al., 2015
[7] Windbichler N., et al., 2008
[8] Wright PR., et al., 2013
External database links:  
ECOCYC:
SPF-RNA
ECOLIWIKI:
b3864
M3D: small regulatory RNA Spot 42


Regulation exerted by the small RNA    
  Target Mechanism Function Target Type Binding Site Evidence
Code
Reference(s)
LeftPos RightPos Sequence
 
MRNA-DEGRADATION
repressor
Gene
789924
789999
GCAGGGUAGCCAAAUGCGUUGGCAAACAGAGAUUGUGUUUUUUCUUUCAGACUCAUUUCUUACACUCCGGAUUCGC
 
TRANSLATION-BLOCKING
repressor
Gene
755122
755133
ACCUCUGUGCCC
 
nd
repressor
Gene
1986158
1986165
GUAGGGCA
 
nd
repressor
Gene
2839496
2839503
UACCCUAC
 
nd
repressor
Gene
2323411
2323418
CUGUACCC
 
nd
repressor
Gene
40382
40396
UCCAUCUUUCAACCU
 
nd
activator
Gene
nd
nd
nd
 
nd
repressor
Gene
nd
nd
nd
 
nd
repressor
Gene
2934212
2934268
GCUUCUGAACCUAAGAGGAUGCUAUGGGAAACACAUCAAUACAAACGCAGAGUUACC
 
nd
repressor
Gene
nd
nd
nd
 
nd
repressor
Gene
2934196
2934206
CCGAUUACGUG
 
nd
repressor
Gene
1842450
1842464
CCGUUCGUGAAGUAA
[8]
 
nd
repressor
Gene
4118088
4118098
CAUAAUCGGAU
 
nd
repressor
Gene
754590
754599
GGGUACAGAG
 
gss
nd
activator
Gene
nd
nd
nd
 
nd
repressor
Gene
nd
nd
nd
 
nd
repressor
Gene
nd
nd
nd
 
nd
repressor
Gene
4539517
4539534
GUAGGAUACAGAAAGCAA
 
nd
repressor
Gene
3372624
3372634
GUAGGGUACAG
 
nd
repressor
Gene
1462115
1462123
GUACCCUAC
 
nd
repressor
Gene
1365515
1365548
UCCGAUUAACCGUGAAGAGUCAAAAGGUGUGAAA
 
nd
repressor
Gene
2825817
2825831
CUGAAGGAGAGAACA
 
nd
repressor
Gene
4160769
4160776
CGUAAUCG
 
nd
repressor
Gene
762994
763005
CUGAAGGAUGGA
[8]
 
nd
repressor
Gene
3731132
3731170
UGAAAAUAAAGAACAUUCUACUCACCCUUUGCACCUCAC
 
nd
repressor
Gene
nd
nd
nd
 
nd
repressor
Gene
nd
nd
nd
Evidence: [IDA] Inferred from direct assay
[IEP] Inferred from expression pattern
[IMP] Inferred from mutant phenotype
[SM] Site mutation


Reference(s)    

 [1] Chen S., Lesnik EA., Hall TA., Sampath R., Griffey RH., Ecker DJ., Blyn LB., 2002, A bioinformatics based approach to discover small RNA genes in the Escherichia coli genome., Biosystems 65(2-3):157-77

 [2] Joyce CM., Grindley ND., 1982, Identification of two genes immediately downstream from the polA gene of Escherichia coli., J Bacteriol 152(3):1211-9

 [3] Komine Y., Inokuchi H., 1991, Physical map locations of the genes that encode small stable RNAs in Escherichia coli., J Bacteriol 173(17):5252

 [4] Mihailovic MK., Vazquez-Anderson J., Li Y., Fry V., Vimalathas P., Herrera D., Lease RA., Powell WB., Contreras LM., 2018, High-throughput in vivo mapping of RNA accessible interfaces to identify functional sRNA binding sites., Nat Commun 9(1):4084

 [5] Moller T., Franch T., Udesen C., Gerdes K., Valentin-Hansen P., 2002, Spot 42 RNA mediates discoordinate expression of the E. coli galactose operon., Genes Dev 16(13):1696-706

 [6] Wang X., Ji SC., Jeon HJ., Lee Y., Lim HM., 2015, Two-level inhibition of galK expression by Spot 42: Degradation of mRNA mK2 and enhanced transcription termination before the galK gene., Proc Natl Acad Sci U S A 112(24):7581-6

 [7] Windbichler N., von Pelchrzim F., Mayer O., Csaszar E., Schroeder R., 2008, Isolation of small RNA-binding proteins from E. coli: evidence for frequent interaction of RNAs with RNA polymerase., RNA Biol 5(1):30-40

 [8] Wright PR., Richter AS., Papenfort K., Mann M., Vogel J., Hess WR., Backofen R., Georg J., 2013, Comparative genomics boosts target prediction for bacterial small RNAs., Proc Natl Acad Sci U S A 110(37):E3487-96

 [9] Moller T., Franch T., Hojrup P., Keene DR., Bachinger HP., Brennan RG., Valentin-Hansen P., 2002, Hfq: a bacterial Sm-like protein that mediates RNA-RNA interaction., Mol Cell 9(1):23-30

 [10] Desnoyers G., Masse E., 2012, Noncanonical repression of translation initiation through small RNA recruitment of the RNA chaperone Hfq., Genes Dev 26(7):726-39

 [11] Chen J., Gottesman S., 2017, Spot 42 sRNA regulates arabinose-inducible araBAD promoter activity by repressing synthesis of the high-affinity low-capacity arabinose transporter., J Bacteriol 199(3):e00691-16

 [12] Beisel CL., Updegrove TB., Janson BJ., Storz G., 2012, Multiple factors dictate target selection by Hfq-binding small RNAs., EMBO J 31(8):1961-74

 [13] Beisel CL., Storz G., 2011, The base-pairing RNA spot 42 participates in a multioutput feedforward loop to help enact catabolite repression in Escherichia coli., Mol Cell 41(3):286-97


RegulonDB