RegulonDB RegulonDB 10.9: smallRNA Form
   

Qin prophage; small regulatory RNA DicF small RNA in Escherichia coli K-12 genome


Gene local context to scale (view description)

ydfC dicB dicF ydfD terminator anti-terminator anti-anti-terminator dicBp dicBp
small RNA      
Gene name: dicF    Texpresso search in the literature
Synonym(s): DicF
Genome position: 1649382 --> 1649434
Strand: forward
Sequence: Get ribonucleotide sequence FastaFormat
GC content %:  
54.72
Note(s): The DicF small regulatory RNA acts to inhibit cell division 2477663. DicF causes inhibition of the formation of the constriction and the separation of the replicated chromosomes into the daughter nucleoids Tetart F,1992.
DicF interferes with translation of ftsZ Tetart F,1992 by base-pairing with the ftsZ mRNA Balasubramanian D,2016. Additional direct targets include xylR and pykA; different residues within DicF are used for base-pairing with the different targets Balasubramanian D,2016. Like SgrS, DicF was found to regulate the translation of manX indirectly, by facilitating the interaction of Hfq with a site near the ribosome binding site, which then inhibits initiation of translation Azam MS,2018.
Under anaerobic conditions, the enolase component of the |FRAME: CPLX0-2381| together with Hfq stabilizes DicF, leading to a predominantly filamentous morphology of the cells 28874523.
The DicF-mediated delay in nucleoid segregation is suppressed by FtsZ overproduction Tetart F,1992. The DicF-mediated decrease in FtsZ abundance and activity is suppressed by an rpoB mutation, and this effect is partially counteracted by an rpoS mutation Cam K,1995.
DicF was shown to bind to Hfq Zhang A,2003 with a Kd of about 16 nM 21510661. The DicF RNA is appears to be generated via processing of a larger transcript by RNase III and RNase E Faubladier M,1990. 28874523. DicF predominantly accumulates under oxygen-limited conditions 28874523.
Genes similar to dicF occur in multiple prophage-like elements in a variety of genomes 7508908.
Overexpression of DicF leads to decreased expression of RpoS Mandin P,2010, slower cell growth and decreased swimming and swarming motility and biofilm formation Bak G,2015.
Reviews: 7540245. 10068996. 15063850. 15487940. 30006994. 32213244
Evidence: [IGI] Inferred from genetic interaction
[IMP] Inferred from mutant phenotype
Reference(s): [1] Balasubramanian D., et al., 2016
[2] Tetart F., et al., 1992
[3] Windbichler N., et al., 2008
[4] van Helvoort JM., et al., 1996
External database links:  
ECOCYC:
DICF-RNA
ECOLIWIKI:
b1574
M3D: Qin prophage; small regulatory RNA DicF


Regulation exerted by the small RNA    
  Target Mechanism Function Target Type Binding Site Evidence
Code
Reference(s)
LeftPos RightPos Sequence
 
TRANSLATION-BLOCKING
repressor
Gene
105277
105304
GGCGACAGGCACAAAUCGGAGAGAAACU
 
TRANSLATION-BLOCKING
repressor
Gene
3734988
3734997
AAACGUCACC
[1]
 
TRANSLATION-BLOCKING, MRNA-DEGRADATION
repressor
Gene
1937631
1937648
CAGUCAACGGAGUAUUAC
[1]
 
nd
repressor
Gene
1902082
1902099
GGGCUGCAGAGCAGUUGC
[6]
Evidence: [IMP] Inferred from mutant phenotype
[SM] Site mutation
[IEP] Inferred from expression pattern


Reference(s)    

 [1] Balasubramanian D., Ragunathan PT., Fei J., Vanderpool CK., 2016, A Prophage-Encoded Small RNA Controls Metabolism and Cell Division in Escherichia coli., mSystems 1(1)

 [2] Tetart F., Albigot R., Conter A., Mulder E., Bouche JP., 1992, Involvement of FtsZ in coupling of nucleoid separation with septation., Mol Microbiol 6(5):621-7

 [3] Windbichler N., von Pelchrzim F., Mayer O., Csaszar E., Schroeder R., 2008, Isolation of small RNA-binding proteins from E. coli: evidence for frequent interaction of RNAs with RNA polymerase., RNA Biol 5(1):30-40

 [4] van Helvoort JM., Kool J., Woldringh CL., 1996, Chloramphenicol causes fusion of separated nucleoids in Escherichia coli K-12 cells and filaments., J Bacteriol 178(14):4289-93

 [5] Tetart F., Bouche JP., 1992, Regulation of the expression of the cell-cycle gene ftsZ by DicF antisense RNA. Division does not require a fixed number of FtsZ molecules., Mol Microbiol 6(5):615-20

 [6] Azam MS., Vanderpool CK., 2018, Translational regulation by bacterial small RNAs via an unusual Hfq-dependent mechanism., Nucleic Acids Res 46(5):2585-2599


RegulonDB