RegulonDB RegulonDB 10.9: smallRNA Form
   

small regulatory RNA OxyS small RNA in Escherichia coli K-12 genome


Gene local context to scale (view description)

argH oxyR oxyS sthA OxyR OxyR terminator oxyRp oxyRp oxySp oxySp TSS_4687 (cluster) TSS_4687 (cluster)
small RNA      
Gene name: oxyS    Texpresso search in the literature
Synonym(s): OxyS
Genome position: 4158278 <-- 4158394
Strand: reverse
Sequence: Get ribonucleotide sequence FastaFormat
GC content %:  
46.15
Note(s): OxyS is a small RNA that plays a regulatory role in the oxidative stress response and has an antimutator effect Altuvia S,1997. Expression of OxyS in response to oxidative stress impairs cell division and enables more efficient recovery Barshishat S,2018. OxyS is involved in regulation of fhlA Altuvia S,1997. Altuvia S,1998. Salim NN,2010, rpoS Altuvia S,1997. 9478196. Zhang A,1998. Mandin P,2010, and flhDC De Lay N,2012. Additional regulatory targets were computationally predicted and verified by Northern analysis 16717284. OxyS also regulates the generation of intracellular H2O2 10368161.
OxyS interacts with the Hfq protein Zhang A,1998. Zhang A,2002. 21510661. 23804244, which stimulates pairing of regions of OxyS RNA with its mRNA target Zhang A,2002. Interaction with Hfq alters the secondary structure of OxyS 23804244. Crystal structures of the A-rich linker region of OxyS binding at the distal side of Hfq have been solved 25670676. OxyS RNA binds to fhlA mRNA and inhibits translation by interfering with the binding of the mRNA by the ribosome Altuvia S,1998. Argaman L,2000. The Hfq-mediated interaction between OxyS and flhA appears to be between the N-site bases of (ARN)X motifs 28852099.
The mechanism of rpoS regulation by OxyS was long unclear. The 5' end of a stem-loop region in OxyS may base pair with the rpoS mRNA 16039523; direct interaction of OxyS with rpoS mRNA has been shown 21793590. However, while its interaction with Hfq is strong, OxyS only shows weak affinity for the rpoS leader region. Regulation by small RNAs can be affected by competition for Hfq 21189298; regulation of rpoS translation by OxyS may thus be due to sequestration of Hfq rather than binding to rpoS mRNA Updegrove TB,2011. Indeed, expression of OxyS at physiologically relevant levels reduces the abundance of other small RNAs including DsrA (a positive regulator of rpoS) and reduces their association with Hfq. Increased levels of Hfq overcome this competition effect Moon K,2011.
Overexpression of OxyS decreases growth due to increased repression of nusG expression, which in turn allows increased expression of kilR. KilR interferes with cell division, thus enabling recovery from oxidative stress Barshishat S,2018.
The secondary structure of OxyS has been mapped by various methods 21793590. Additional interactions of OxyS with ribosomal protein S1 and the β subunit of RNA polymerase were identified Windbichler N,2008.
OxyS RNA is abundant and relatively stable, with a half life measured to be 12-15 minutes Altuvia S,1997 or approximately 22 minutes 20016254. Growth phase does not affect the stability of OxyS in the MG1655 strain background. However, in a hfq mutant strain the stability of OxyS in stationary phase is significantly decreased 20016254.
Transcription of oxyS is induced by hydrogen peroxide stress Altuvia S,1997. Levels of OxyS are higher in a lon mutant than in wild type 16750174. Degradation of OxyS RNA is probably stimulated by RNA duplex formation between the sRNA and its target RNA 12975324. Overexpression of OxyS decreases swimming and swarming motility and curli expression Bak G,2015 and inhibits growth by impairing cell division Barshishat S,2018.
Reviews: 9830102. 10068996. 11804580. 12753181. 12732300. 15063850. 15487940. 23070552. Negrete A,2017. Frohlich KS,2018. 32213244
Evidence: [IMP] Inferred from mutant phenotype
Reference(s): [1] Akay A., et al., 2015
[2] Alkan C., et al., 2006
[3] Altuvia S., et al., 1997
[4] Cho H., et al., 2018
[5] Doi H., et al., 2014
[6] Fratczak A., et al., 2009
[7] Goeser L., et al., 2015
[8] Haridas V., et al., 2005
[9] Idil O., et al., 2016
[10] Kim T., et al., 2015
[11] Liu H., et al., 2012
[12] Malecka EM., et al., 2015
[13] Rosner JL., et al., 1994
[14] Sheng H., et al., 2017
[15] Sridhar J., et al., 2007
[16] Storz G. 2016
[17] Updegrove TB., et al., 2011
[18] Wu TH., et al., 2010
External database links:  
ECOCYC:
OXYS-RNA
ECOLIWIKI:
b4458
M3D: small regulatory RNA OxyS


Regulation exerted by the small RNA    
  Target Mechanism Function Target Type Binding Site Evidence
Code
Reference(s)
LeftPos RightPos Sequence
 
TRANSLATION-BLOCKING
repressor
Gene
2854323
2854329
UCCUGGA
 
TRANSLATION-BLOCKING
repressor
Gene
2854371
2854379
CAAGGGUUG
 
TRANSLATION-BLOCKING
repressor
TU
nd
nd
nd
 
nd
repressor
TU
1978200
1978219
UUCCCACCCAGAAUAACCAA
 
nd
repressor
Gene
4177722
4177755
UCACUGGCCUGAGGUUCUGAGAUGUCUGAAGCUC
Evidence: [SM] Site mutation
[IDA] Inferred from direct assay
[IMP] Inferred from mutant phenotype
[GEA] Gene expression analysis
[NABE] Nucleic acid binding evidence


Reference(s)    

 [1] Akay A., Sarkies P., Miska EA., 2015, E. coli OxyS non-coding RNA does not trigger RNAi in C. elegans., Sci Rep 5:9597

 [2] Alkan C., Karakoc E., Nadeau JH., Sahinalp SC., Zhang K., 2006, RNA-RNA interaction prediction and antisense RNA target search., J Comput Biol 13(2):267-82

 [3] Altuvia S., Weinstein-Fischer D., Zhang A., Postow L., Storz G., 1997, A small, stable RNA induced by oxidative stress: role as a pleiotropic regulator and antimutator., Cell 90(1):43-53

 [4] Cho H., Kim KS., 2018, Escherichia coli OxyS RNA triggers cephalothin resistance by modulating the expression of CRP-associated genes., Biochem Biophys Res Commun 506(1):66-72

 [5] Doi H., Hoshino Y., Nakase K., Usuda Y., 2014, Reduction of hydrogen peroxide stress derived from fatty acid beta-oxidation improves fatty acid utilization in Escherichia coli., Appl Microbiol Biotechnol 98(2):629-39

 [6] Fratczak A., Kierzek R., Kierzek E., 2009, LNA-modified primers drastically improve hybridization to target RNA and reverse transcription., Biochemistry 48(3):514-6

 [7] Goeser L., Fan TJ., Tchaptchet S., Stasulli N., Goldman WE., Sartor RB., Hansen JJ., 2015, Small heat-shock proteins, IbpAB, protect non-pathogenic Escherichia coli from killing by macrophage-derived reactive oxygen species., PLoS One 10(3):e0120249

 [8] Haridas V., Kim SO., Nishimura G., Hausladen A., Stamler JS., Gutterman JU., 2005, Avicinylation (thioesterification): a protein modification that can regulate the response to oxidative and nitrosative stress., Proc Natl Acad Sci U S A 102(29):10088-93

 [9] Idil O., Macit I., Kaygusuz O., Darcan C., 2016, The role of oxidative stress genes and effect of pH on methylene blue sensitized photooxidation of Escherichia coli., Acta Biol Hung 67(1):85-98

 [10] Kim T., Bak G., Lee J., Kim KS., 2015, Systematic analysis of the role of bacterial Hfq-interacting sRNAs in the response to antibiotics., J Antimicrob Chemother 70(6):1659-68

 [11] Liu H., Wang X., Wang HD., Ren J., Meng L., Wu Q., Dong H., Wu J., Kao TY., Ge Q., Wu ZX., Yuh CH., Shan G., 2012, Escherichia coli noncoding RNAs can affect gene expression and physiology of Caenorhabditis elegans., Nat Commun 3:1073

 [12] Malecka EM., Strozecka J., Sobanska D., Olejniczak M., 2015, Structure of bacterial regulatory RNAs determines their performance in competition for the chaperone protein Hfq., Biochemistry 54(5):1157-70

 [13] Rosner JL., Storz G., 1994, Effects of peroxides on susceptibilities of Escherichia coli and Mycobacterium smegmatis to isoniazid., Antimicrob Agents Chemother 38(8):1829-33

 [14] Sheng H., Stauffer WT., Hussein R., Lin C., Lim HN., 2017, Nucleoid and cytoplasmic localization of small RNAs in Escherichia coli., Nucleic Acids Res 45(5):2919-2934

 [15] Sridhar J., Rafi ZA., 2007, Identification of novel genomic islands associated with small RNAs., In Silico Biol 7(6):601-11

 [16] Storz G., 2016, New perspectives: Insights into oxidative stress from bacterial studies., Arch Biochem Biophys 595:25-7

 [17] Updegrove TB., Correia JJ., Chen Y., Terry C., Wartell RM., 2011, The stoichiometry of the Escherichia coli Hfq protein bound to RNA., RNA 17(3):489-500

 [18] Wu TH., Chang IY., Chu LC., Huang HC., Ng WV., 2010, Modularity of Escherichia coli sRNA regulation revealed by sRNA-target and protein network analysis., BMC Bioinformatics 11 Suppl 7:S11

 [19] Altuvia S., Zhang A., Argaman L., Tiwari A., Storz G., 1998, The Escherichia coli OxyS regulatory RNA represses fhlA translation by blocking ribosome binding., EMBO J 17(20):6069-75

 [20] Salim NN., Feig AL., 2010, An upstream Hfq binding site in the fhlA mRNA leader region facilitates the OxyS-fhlA interaction., PLoS One 5(9)

 [21] Zhang A., Wassarman KM., Ortega J., Steven AC., Storz G., 2002, The Sm-like Hfq protein increases OxyS RNA interaction with target mRNAs., Mol Cell 9(1):11-22

 [22] Argaman L., Altuvia S., 2000, fhlA repression by OxyS RNA: kissing complex formation at two sites results in a stable antisense-target RNA complex., J Mol Biol 300(5):1101-12

 [23] Moon K., Gottesman S., 2011, Competition among Hfq-binding small RNAs in Escherichia coli., Mol Microbiol 82(6):1545-62

 [24] Updegrove TB., Wartell RM., 2011, The influence of Escherichia coli Hfq mutations on RNA binding and sRNA-mRNA duplex formation in rpoS riboregulation., Biochim Biophys Acta 1809(10):532-40

 [25] Zhang A., Altuvia S., Tiwari A., Argaman L., Hengge-Aronis R., Storz G., 1998, The OxyS regulatory RNA represses rpoS translation and binds the Hfq (HF-I) protein., EMBO J 17(20):6061-8

 [26] De Lay N., Gottesman S., 2012, A complex network of small non-coding RNAs regulate motility in Escherichia coli., Mol Microbiol 86(3):524-38

 [27] Barshishat S., Elgrably-Weiss M., Edelstein J., Georg J., Govindarajan S., Haviv M., Wright PR., Hess WR., Altuvia S., 2018, OxyS small RNA induces cell cycle arrest to allow DNA damage repair., EMBO J 37(3):413-426


RegulonDB