RegulonDB RegulonDB 10.9: smallRNA Form
   

small regulatory RNA MicA small RNA in Escherichia coli K-12 genome


Gene local context to scale (view description)

gshA luxS micA CyaR terminator anti-terminator anti-anti-terminator TSS_3000 TSS_3000 TSS_2999 TSS_2999 TSS_2998 TSS_2998 luxSp1 luxSp1 luxSp2 luxSp2 micAp micAp
small RNA      
Gene name: micA    Texpresso search in the literature
Synonym(s): MicA, PsrA10, SraD
Genome position: 2814802 --> 2814874
Strand: forward
Sequence: Get ribonucleotide sequence FastaFormat
GC content %:  
42.47
Note(s): MicA is a small RNA that negatively regulates expression of a number of genes. The first identified target of MicA was OmpA, whose expression is regulated during stationary phase Udekwu KI,2005. Rasmussen AA,2005. Urban JH,2007. MicA acts as an antisense RNA, binding to the translation initiation region of ompA mRNA and blocking ribosome binding, thereby downregulating OmpA expression. This downregulation requires the RNA-binding protein Hfq Udekwu KI,2005. Rasmussen AA,2005. Hfq acts as an RNA chaperone, bringing MicA and ompA into close proximity and restructuring MicA to expose the ompA-binding site for pairing 23361466.
In addition, MicA downregulates expression of a number of other genes. The list includes phoPQ, linking the PhoPQ regulon to the envelope stress response Coornaert A,2010. Coornaert A,2013, and a number of other genes Gogol EB,2011. However, MicA does not appear to play a role in regulating temperature-dependent lpxT expression Sciandrone B,2019. MicA can downregulate expression of OmpX, likely under conditions where its primary regulator, CyaR, is poorly expressed Johansen J,2008. MicA positively regulates motility, but not by regulating the expression of flhDC De Lay N,2012.
MicA is able to form dimers; self-association is dependent on Mg2+ concentration and obstructs the ompA binding site 23361466.
A micA deletion mutant is sensitive to cell envelope stress Hobbs EC,2010 and appears unable to establish long-term stationary phase Nagamitsu H,2013. Overexpression of either MicA or RybB rescues the growth and viability phenotypes of σE depletion Gogol EB,2011 and also leads to increased cell lysis in stationary phase 22251246. Conversely, deletion of micA partly restores stationary phase viability of a ΔrseA mutant Nicoloff H,2017. Overexpression of MicA increases swimming motility and decreases swarming motility and expression of type I fimbriae Bak G,2015.
Expression of micA is controlled by the alternative sigma factor σE Johansen J,2006. 17267407. Lacoux C,2020 and is increased upon entry into stationary phase Argaman L,2001. Udekwu KI,2005. Proper regulation of micA expression by σE is critical Nicoloff H,2017. The transcripts of many MicA targets are decreased after σE induction as expected Lacoux C,2020. MicA levels in stationary phase are increased in a pnp mutant 18203924. The half life of micA in stationary phase is 4 minutes Vogel J,2003. |FRAME: EG10743-MONOMER PNPase| and |FRAME: EG10863-MONOMER| together stabilize MicA during exponential growth; stabilization is dependent on Hfq binding to the 3' tail of MicA 27698082.
SraD: small RNA D Argaman L,2001
Reviews: 17055775. 26618164. Frohlich KS,2018. 32213244
Evidence: [IDA] Inferred from direct assay
[IMP] Inferred from mutant phenotype
Reference(s): [1] Guo MS., et al., 2014
[2] Hammann P., et al., 2014
[3] Mihailovic MK., et al., 2018
[4] Moores A., et al., 2014
[5] Nagamitsu H., et al., 2013
[6] Rasmussen AA., et al., 2005
[7] Udekwu KI. 2010
[8] Udekwu KI., et al., 2005
[9] Vincent HA., et al., 2013
[10] Zhang S., et al., 2018
External database links:  
ECOCYC:
SRAD-RNA
ECOLIWIKI:
b4442
M3D: small regulatory RNA MicA


Regulation exerted by the small RNA    
  Target Mechanism Function Target Type Binding Site Evidence
Code
Reference(s)
LeftPos RightPos Sequence
 
TRANSLATION-BLOCKING
repressor
TU
1020059
1020074
GCGCCUCGUUAUCAUC
 
TRANSLATION-BLOCKING
repressor
TU
1020059
1020074
GCGCCUCGUUAUCAUC
 
TRANSLATION-BLOCKING, MRNA-DEGRADATION
repressor
TU
1190440
1190462
ACGCGCAUUUUUAUUUCUCCCUG
 
nd
repressor
Gene
779534
779572
GGGUCAUGACGAAGCGGCAUACUCCAAAAACCGUCGUGC
 
nd
repressor
Gene
779534
779572
GGGUCAUGACGAAGCGGCAUACUCCAAAAACCGUCGUGC
 
nd
repressor
TU
4376542
4376572
AGGAAGACGUUAUGGUGAAGAAGACAAUUGC
 
nd
repressor
TU
4540901
4540936
GGAUUAUUGCUAACCCAGCACAGCUAGUGCGCGUCU
 
nd
repressor
TU
4540901
4540936
GGAUUAUUGCUAACCCAGCACAGCUAGUGCGCGUCU
 
nd
repressor
Gene
1727824
1727849
UGAGGAUAAAAAGAUGCGUCUUCUUC
 
nd
repressor
Gene
4247961
4247988
AGGAGAUAGAAUGAUGAUUACUCUGCGC
 
nd
repressor
TU
1170356
1170383
AACGCGUUUUGAUCAUCACCAAAAAUCC
 
nd
repressor
Gene
2268763
2268784
GGAAUGCCUUGCAGAGCGCGCU
 
nd
repressor
TU
1314013
1314045
AGCGGAUAUGAAAAAGUUAACAGUGGCGGCUUU
 
nd
repressor
TU
850450
850472
AUGAAAAAAAUUGCAUGUCUUUC
 
pal
nd
repressor
Gene
779090
779109
AGGGCUGAUGAUUGCUCUGC
 
nd
repressor
TU
779090
779109
AGGGCUGAUGAUUGCUCUGC
 
tsx
nd
repressor
TU
432049
432071
GAAAAAGGCGCAAAUUGCGUUUC
 
tsx
nd
repressor
TU
432049
432071
GAAAAAGGCGCAAAUUGCGUUUC
 
nd
repressor
Gene
2537327
2537361
GGAUAAGGUAAUUCAAUGAAGAAAAUCAUUUGUCU
 
nd
repressor
Gene
3201118
3201150
AGAGGAUUCCGAUUGAUGUCGAAUGCUUUGCGU
 
nd
repressor
TU
850450
850472
AUGAAAAAAAUUGCAUGUCUUUC
Evidence: [IDA] Inferred from direct assay
[SM] Site mutation
[IPI] Inferred from physical interaction
[IEP] Inferred from expression pattern
[IMP] Inferred from mutant phenotype


Reference(s)    

 [1] Guo MS., Updegrove TB., Gogol EB., Shabalina SA., Gross CA., Storz G., 2014, MicL, a new σE-dependent sRNA, combats envelope stress by repressing synthesis of Lpp, the major outer membrane lipoprotein., Genes Dev 28(14):1620-34

 [2] Hammann P., Parmentier D., Cerciat M., Reimegard J., Helfer AC., Boisset S., Guillier M., Vandenesch F., Wagner EG., Romby P., Fechter P., 2014, A method to map changes in bacterial surface composition induced by regulatory RNAs in Escherichia coli and Staphylococcus aureus., Biochimie 106:175-9

 [3] Mihailovic MK., Vazquez-Anderson J., Li Y., Fry V., Vimalathas P., Herrera D., Lease RA., Powell WB., Contreras LM., 2018, High-throughput in vivo mapping of RNA accessible interfaces to identify functional sRNA binding sites., Nat Commun 9(1):4084

 [4] Moores A., Chipper-Keating S., Sun L., McVicker G., Wales L., Gashi K., Blomfield IC., 2014, RfaH Suppresses Small RNA MicA Inhibition of fimB Expression in Escherichia coli K-12., J Bacteriol 196(1):148-56

 [5] Nagamitsu H., Murata M., Kosaka T., Kawaguchi J., Mori H., Yamada M., 2013, Crucial roles of MicA and RybB as vital factors for σ-dependent cell lysis in Escherichia coli long-term stationary phase., J Mol Microbiol Biotechnol 23(3):227-32

 [6] Rasmussen AA., Eriksen M., Gilany K., Udesen C., Franch T., Petersen C., Valentin-Hansen P., 2005, Regulation of ompA mRNA stability: the role of a small regulatory RNA in growth phase-dependent control., Mol Microbiol 58(5):1421-9

 [7] Udekwu KI., 2010, Transcriptional and post-transcriptional regulation of the Escherichia coli luxS mRNA; involvement of the sRNA MicA., PLoS One 5(10):e13449

 [8] Udekwu KI., Darfeuille F., Vogel J., Reimegard J., Holmqvist E., Wagner EG., 2005, Hfq-dependent regulation of OmpA synthesis is mediated by an antisense RNA., Genes Dev 19(19):2355-66

 [9] Vincent HA., Phillips JO., Henderson CA., Roberts AJ., Stone CM., Mardle CE., Butt LE., Gowers DM., Pickford AR., Callaghan AJ., 2013, An improved method for surface immobilisation of RNA: application to small non-coding RNA-mRNA pairing., PLoS One 8(11):e79142

 [10] Zhang S., Liu S., Wu N., Yuan Y., Zhang W., Zhang Y., 2018, Small Non-coding RNA RyhB Mediates Persistence to Multiple Antibiotics and Stresses in Uropathogenic Escherichia coli by Reducing Cellular Metabolism., Front Microbiol 9:136

 [11] Coornaert A., Chiaruttini C., Springer M., Guillier M., 2013, Post-transcriptional control of the Escherichia coli PhoQ-PhoP two-component system by multiple sRNAs involves a novel pairing region of GcvB., PLoS Genet 9(1):e1003156

 [12] Coornaert A., Lu A., Mandin P., Springer M., Gottesman S., Guillier M., 2010, MicA sRNA links the PhoP regulon to cell envelope stress., Mol Microbiol 76(2):467-79

 [13] Gogol EB., Rhodius VA., Papenfort K., Vogel J., Gross CA., 2011, Small RNAs endow a transcriptional activator with essential repressor functions for single-tier control of a global stress regulon., Proc Natl Acad Sci U S A 108(31):12875-80

 [14] Johansen J., Eriksen M., Kallipolitis B., Valentin-Hansen P., 2008, Down-regulation of Outer Membrane Proteins by Noncoding RNAs: Unraveling the cAMP-CRP- and sigma(E)-Dependent CyaR-ompX Regulatory Case., J Mol Biol 383(1):1-9


RegulonDB