RegulonDB RegulonDB 10.9: smallRNA Form
   

small regulatory RNA RyhB small RNA in Escherichia coli K-12 genome


Gene local context to scale (view description)

yhhX yhhY ryhB Fur Fur Fur yhhYp yhhYp yhhXp5 yhhXp5 yhhXp4 yhhXp4 TSS_4054 TSS_4054
small RNA      
Gene name: ryhB    Texpresso search in the literature
Synonym(s): IS176, PsrA18, RyhB, RyhB small regulatory RNA involved in iron homeostasis, SraI
Genome position: 3580922 <-- 3581016
Strand: reverse
Sequence: Get ribonucleotide sequence FastaFormat
GC content %:  
50.53
Note(s): RyhB is a small RNA which acts to reduce iron consumption under low-iron conditions by downregulating expression of iron-containing proteins, including enzymes of the TCA cycle and the aerobic respiratory chain Masse E,2002. Masse E,2005. 16982641. Desnoyers G,2012. In addition, RyhB promotes synthesis of the siderophore enterobactin Salvail H,2010. RyhB was first identified as a small RNA of approximately 90 nt in length Wassarman KM,2001. Argaman L,2001.
RIBOseq data suggests that in E. coli O157:H7 EDL933, a small open reading frame within RyhB that begins with an ATT start codon may be translated to the nonapeptide MAHIASSIT 28245801.
Structural and functional components of RyhB were identified using a library of single nucleotide mutants and evaluating their effects on known regulatory targets Peterman N,2014. Theoretical analysis and quantitative evaluation of regulation by RyhB has been performed 17713988. Prediction of regulatory targets of RyhB can be improved by considering accessible regions in both the sRNA and its target 22767260 and by simulation of the effect of the sRNA on translation initiation 23203192. Additional targets have been predicted by microarray and computational analyses and comparative genomics Masse E,2005. 16717284. Wright PR,2013 and experimentally identified by an affinity purification method Lalaouna D,2015 and by Ribo-seq 26546513.
Regulatory Targets of RyhB
RyhB downregulates full-length sdhCDAB RNA abundance Masse E,2002. RyhB also mediates regulation of acnA, fumA, bfr, sodB Masse E,2002 and acnB Masse E,2005. Benjamin JA,2014 by Fur. Indirect regulation by Fur during anaerobic growth conditions revealed a new set of targets regulated by RyhB 26670385. RyhB was shown to inhibit translation of sodB in vitro Vecerek B,2003 and stimulate degradation of sodB mRNA by RNase E 12975324. In the absence of RNase E, gene silencing can occur by translational repression alone 16549791; conversely, RyhB-induced mRNA cleavage at a distal site by RNase E does not require translation Prevost K,2011. Quantitative analysis of the interaction between wild-type and mutant RyhB and sodB mRNA correlates with thermodynamic models of this interaction and show that a continuum of repression strengths is achievable. Surprisingly, a truncated form of RyhB is able to regulate certain targets independently of Hfq 21742981. Phenotypic noise caused by RyhB regulation of sodB and fumA has been measured; extrinsic noise was found to be dominant 23519613.
RyhB indirectly down-regulates Fur expression by down-regulating expression of the translationally coupled upstream reading frame Uof Vecerek B,2007. The characteristics of feed-forward regulation of SodA expression by Fur and RyhB has been modeled 24621982. The cysE gene has also been identified as a direct target of RyhB regulation. Downregulating the expression of the serine acetyltransferase CysE increases the availability of serine for the production of enterobactin Salvail H,2010. RyhB overexpression decreases expression of hemB and hemH in the engineered DALA strain Li F,2014.
RyhB was shown to promote cleavage of the polycistronic iscRSUA mRNA between the iscR and iscS open reading frames. The IscR-encoding 5' fragment remains stable, while the iscSUA 3' fragment appears to be degraded Desnoyers G,2009.
RyhB increases expression of the shikimate transporter ShiA by increasing shiA mRNA stability and activating translation Prevost K,2007. RyhB is required for synthesis of CirA during iron starvation: Hfq blocks translation initiation, and binding of RyhB leads to changes in the mRNA secondary structure, thereby displacing Hfq |...
Evidence: [IDA] Inferred from direct assay
[IMP] Inferred from mutant phenotype
Reference(s): [1] Arbel-Goren R., et al., 2016
[2] Baez A., et al., 2017
[3] Bos J., et al., 2013
[4] Chen S., et al., 2002
[5] Kang Z., et al., 2012
[6] King AM., et al., 2019
[7] Liu F., et al., 2018
[8] Lyu Y., et al., 2019
[9] Mandin P., et al., 2016
[10] Masse E., et al., 2002
[11] Mihailovic MK., et al., 2018
[12] Mitarai N., et al., 2009
[13] Orchard SS., et al., 2012
[14] Sheng H., et al., 2017
[15] Vecerek B., et al., 2003
[16] Zhang J., et al., 2016
External database links:  
ECOCYC:
SRAI-RNA
ECOLIWIKI:
b4451
M3D: small regulatory RNA RyhB


Regulation exerted by the small RNA    
  Target Mechanism Function Target Type Binding Site Evidence
Code
Reference(s)
LeftPos RightPos Sequence
 
MRNA-DEGRADATION
repressor
Gene
176598
176623
UUGGAGCAAAAUAUGAGUGAUGACGU
 
MRNA-DEGRADATION
repressor
TU
1688373
1688388
GACAUUGUUCUCUCAC
 
MRNA-DEGRADATION
repressor
TU
755162
755170
AUGUGGGCG
 
MRNA-DEGRADATION
repressor
TU
755518
755557
UGUUAUUACUGUCGUGCUUUCACUUCUCGCAGGAGUCCUC
 
TRANSLATION-BLOCKING
repressor
TU
710693
710742
GACAGAAUUUGCUCUUGAGAUAAUGCGUAUCAUUAUAGAAUUGCCACGCC
 
TRANSLATION-BLOCKING, MRNA-DEGRADATION
repressor
TU
131596
131624
GAGAGCGAGGAGAACCGUCGUGCUAGAAG
 
TRANSLATION-BLOCKING, MRNA-DEGRADATION
activator
Gene
2246810
2246827
AUCGCUCACAUCUUCUUC
 
TRANSLATION-BLOCKING, MRNA-DEGRADATION
repressor
TU
2661532
2661557
UGCUCUAUAAACUCCGUACAUCACUC
 
TRANSLATION-BLOCKING, MRNA-DEGRADATION
repressor
TU
1862427
1862439
CAUUUGCUCACAU
[3]
 
TRANSLATION-BLOCKING, MRNA-DEGRADATION
repressor
TU
1862453
1862464
UGCUCACAUUAC
[3]
 
TRANSLATION-BLOCKING, MRNA-DEGRADATION
activator
TU
2053566
2053616
GUUCGUUUAUAGAUCGACGGCAAUGUGAGUUACCUUUUCCAUACUAAUUAU
 
TRANSLATION-BLOCKING, MRNA-DEGRADATION
repressor
TU
1735365
1735382
AAGGAGAGUAGCAAUGUC
 
bfr
nd
repressor
Gene
nd
nd
nd
 
nd
repressor
TU
3782554
3782566
ACACGACAUUGCU
 
nd
repressor
TU
nd
nd
nd
 
nd
repressor
TU
388829
388854
GAACCUAAGCUUUCGAGCACGACUUU
 
nd
repressor
TU
498841
498876
CAGGUGAUGUGCCCGGGCUUUGCUGCGGAUUGUCUG
 
nd
repressor
Gene
1619563
1619578
GAGGUAUGACGAUGUC
 
nd
repressor
Gene
3494002
3494022
GAGGCAAAAAUGAGCAAAGUC
 
nd
repressor
TU
2405062
2405085
GACAUACUCAUUGCUUACUCAUCA
 
nd
repressor
TU
2405062
2405085
GACAUACUCAUUGCUUACUCAUCA
 
nd
repressor
TU
4100794
4100815
AAUACUGGAGAUGAAUAUGAGC
Evidence: [IEP] Inferred from expression pattern
[IMP] Inferred from mutant phenotype
[SM] Site mutation
[IPI] Inferred from physical interaction
[IDA] Inferred from direct assay
[ICA] Inferred by computational analysis


Reference(s)    

 [1] Arbel-Goren R., Tal A., Parasar B., Dym A., Costantino N., Munoz-Garcia J., Court DL., Stavans J., 2016, Transcript degradation and noise of small RNA-controlled genes in a switch activated network in Escherichia coli., Nucleic Acids Res 44(14):6707-20

 [2] Baez A., Shiloach J., 2017, Increasing dissolved-oxygen disrupts iron homeostasis in production cultures of Escherichia coli., Antonie Van Leeuwenhoek 110(1):115-124

 [3] Bos J., Duverger Y., Thouvenot B., Chiaruttini C., Branlant C., Springer M., Charpentier B., Barras F., 2013, The sRNA RyhB Regulates the Synthesis of the Escherichia coli Methionine Sulfoxide Reductase MsrB but Not MsrA., PLoS One 8(5):e63647

 [4] Chen S., Lesnik EA., Hall TA., Sampath R., Griffey RH., Ecker DJ., Blyn LB., 2002, A bioinformatics based approach to discover small RNA genes in the Escherichia coli genome., Biosystems 65(2-3):157-77

 [5] Kang Z., Wang X., Li Y., Wang Q., Qi Q., 2012, Small RNA RyhB as a potential tool used for metabolic engineering in Escherichia coli., Biotechnol Lett 34(3):527-31

 [6] King AM., Vanderpool CK., Degnan PH., 2019, sRNA Target Prediction Organizing Tool (SPOT) Integrates Computational and Experimental Data To Facilitate Functional Characterization of Bacterial Small RNAs., mSphere 4(1)

 [7] Liu F., Zheng K., Chen HC., Liu ZF., 2018, Capping-RACE: a simple, accurate, and sensitive 5' RACE method for use in prokaryotes., Nucleic Acids Res 46(21):e129

 [8] Lyu Y., Wu J., Shi Y., 2019, Metabolic and physiological perturbations of Escherichia coli W3100 by bacterial small RNA RyhB., Biochimie 162:144-155

 [9] Mandin P., Chareyre S., Barras F., 2016, A Regulatory Circuit Composed of a Transcription Factor, IscR, and a Regulatory RNA, RyhB, Controls Fe-S Cluster Delivery., MBio 7(5)

 [10] Masse E., Gottesman S., 2002, A small RNA regulates the expression of genes involved in iron metabolism in Escherichia coli., Proc Natl Acad Sci U S A 99(7):4620-5

 [11] Mihailovic MK., Vazquez-Anderson J., Li Y., Fry V., Vimalathas P., Herrera D., Lease RA., Powell WB., Contreras LM., 2018, High-throughput in vivo mapping of RNA accessible interfaces to identify functional sRNA binding sites., Nat Commun 9(1):4084

 [12] Mitarai N., Benjamin JA., Krishna S., Semsey S., Csiszovszki Z., Masse E., Sneppen K., 2009, Dynamic features of gene expression control by small regulatory RNAs., Proc Natl Acad Sci U S A 106(26):10655-9

 [13] Orchard SS., Rostron JE., Segall AM., 2012, Escherichia coli enterobactin synthesis and uptake mutants are hypersensitive to an antimicrobial peptide that limits the availability of iron in addition to blocking Holliday junction resolution., Microbiology 158(Pt 2):547-59

 [14] Sheng H., Stauffer WT., Hussein R., Lin C., Lim HN., 2017, Nucleoid and cytoplasmic localization of small RNAs in Escherichia coli., Nucleic Acids Res 45(5):2919-2934

 [15] Vecerek B., Moll I., Afonyushkin T., Kaberdin V., Blasi U., 2003, Interaction of the RNA chaperone Hfq with mRNAs: direct and indirect roles of Hfq in iron metabolism of Escherichia coli., Mol Microbiol 50(3):897-909

 [16] Zhang J., Kang Z., Ding W., Chen J., Du G., 2016, Integrated Optimization of the In Vivo Heme Biosynthesis Pathway and the In Vitro Iron Concentration for 5-Aminolevulinate Production., Appl Biochem Biotechnol 178(6):1252-62

 [17] Wright PR., Richter AS., Papenfort K., Mann M., Vogel J., Hess WR., Backofen R., Georg J., 2013, Comparative genomics boosts target prediction for bacterial small RNAs., Proc Natl Acad Sci U S A 110(37):E3487-96

 [18] Masse E., Vanderpool CK., Gottesman S., 2005, Effect of RyhB small RNA on global iron use in Escherichia coli., J Bacteriol 187(20):6962-71

 [19] Prevost K., Desnoyers G., Jacques JF., Lavoie F., Masse E., 2011, Small RNA-induced mRNA degradation achieved through both translation block and activated cleavage., Genes Dev 25(4):385-96

 [20] Desnoyers G., Masse E., 2012, Noncanonical repression of translation initiation through small RNA recruitment of the RNA chaperone Hfq., Genes Dev 26(7):726-39

 [21] Geissmann TA., Touati D., 2004, Hfq, a new chaperoning role: binding to messenger RNA determines access for small RNA regulator., EMBO J 23(2):396-405

 [22] Vecerek B., Moll I., Blasi U., 2007, Control of Fur synthesis by the non-coding RNA RyhB and iron-responsive decoding., EMBO J 26(4):965-75

 [23] Benjamin JA., Masse E., 2014, The iron-sensing aconitase B binds its own mRNA to prevent sRNA-induced mRNA cleavage., Nucleic Acids Res 42(15):10023-36

 [24] Salvail H., Caron MP., Belanger J., Masse E., 2013, Antagonistic functions between the RNA chaperone Hfq and an sRNA regulate sensitivity to the antibiotic colicin., EMBO J 32(20):2764-78

 [25] Desnoyers G., Morissette A., Prevost K., Masse E., 2009, Small RNA-induced differential degradation of the polycistronic mRNA iscRSUA., EMBO J 28(11):1551-61

 [26] Prevost K., Salvail H., Desnoyers G., Jacques JF., Phaneuf E., Masse E., 2007, The small RNA RyhB activates the translation of shiA mRNA encoding a permease of shikimate, a compound involved in siderophore synthesis., Mol Microbiol 64(5):1260-73

 [27] Afonyushkin T., Vecerek B., Moll I., Blasi U., Kaberdin VR., 2005, Both RNase E and RNase III control the stability of sodB mRNA upon translational inhibition by the small regulatory RNA RyhB., Nucleic Acids Res 33(5):1678-89

 [28] Urban JH., Vogel J., 2007, Translational control and target recognition by Escherichia coli small RNAs in vivo., Nucleic Acids Res 35(3):1018-37

 [29] Salvail H., Lanthier-Bourbonnais P., Sobota JM., Caza M., Benjamin JA., Mendieta ME., Lepine F., Dozois CM., Imlay J., Masse E., 2010, A small RNA promotes siderophore production through transcriptional and metabolic remodeling., Proc Natl Acad Sci U S A 107(34):15223-8

 [30] Lalaouna D., Carrier MC., Semsey S., Brouard JS., Wang J., Wade JT., Masse E., 2015, A 3' external transcribed spacer in a tRNA transcript acts as a sponge for small RNAs to prevent transcriptional noise., Mol Cell 58(3):393-405

 [31] Li F., Wang Y., Gong K., Wang Q., Liang Q., Qi Q., 2014, Constitutive expression of RyhB regulates the heme biosynthesis pathway and increases the 5-aminolevulinic acid accumulation in Escherichia coli., FEMS Microbiol Lett 350(2):209-15

 [32] Chareyre S., Barras F., Mandin P., 2019, A small RNA controls bacterial sensitivity to gentamicin during iron starvation., PLoS Genet 15(4):e1008078

 [33] Argaman L., Elgrably-Weiss M., Hershko T., Vogel J., Altuvia S., 2012, RelA protein stimulates the activity of RyhB small RNA by acting on RNA-binding protein Hfq., Proc Natl Acad Sci U S A 109(12):4621-6


RegulonDB