RegulonDB

small RNA
Gene name:	cyaR
Synonym(s):	CyaR, RyeE
Genome position:	2167114 --> 2167200
Strand:	forward
Sequence:	Get ribonucleotide sequence FastaFormat
GC content %:	42.53
Note(s):	CyaR is a small RNA that promotes degradation of the ompX Johansen J,2008. De Lay N,2009, yqaE, nadE, luxS De Lay N,2009 and rpoS Kim W,2020 mRNAs. Additional targets of CyaR have been identified by comparative genomics Wright PR,2013 and by an affinity purification method Lalaouna D,2018. Regulation depends on the presence of Hfq Johansen J,2008. Hfq and CyaR interact Wassarman KM,2001, and Hfq may stabilize CyaR Johansen J,2008. In an hfq mutant, significantly less CyaR accumulates than in wild type Moon K,2011; CyaR is also more unstable in a \|FRAME: EG10743 pnp\| mutant 21527671. \|FRAME: EG10743-MONOMER PNPase\| and \|FRAME: EG10863-MONOMER\| together stabilize CyaR during exponential growth; during stationary phase, CyaR is relatively stable independent of PNPase or RNase PH 27698082. The processed form of the \|FRAME: SRAH-RNA\| downregulates CyaR levels by base-pairing and mediating its RNase E-dependent degradation Kim W,2020. CyaR expression is increased by cAMP-CRP and subject to catabolite repression Johansen J,2008. De Lay N,2009 and is regulated by the CpxAR two-component system Vogt SL,2014. CyaR is expressed at higher levels when cells are grown in pyruvate compared to glucose 31363904. Johansen J,2008 observed that CyaR expression was upregulated by the alternative sigma factor of the envelope stress response, σ^E; however, this regulatory effect was not observed by Guo MS,2014. Overexpression of CyaR decreases curli expression Bak G,2015. Ryx: RNA of unknown function at X position (10 minute) in the genome Wassarman KM,2001 CyaR: cyclic AMP-activated RNA Johansen J,2008 Reviews: Gottesman S,2001. 12654996. 19366629. De la Cruz MA,2010. 21843668. Frohlich KS,2018. 32213244
Evidence:	[IMP] Inferred from mutant phenotype
Reference(s):	[1] De Lay N., et al., 2009 [2] Johansen J., et al., 2008 [3] Mihailovic MK., et al., 2018 [4] Sylwan L., et al., 2010
External database links:

ECOCYC:	RYEE-RNA
ECOLIWIKI:	b4438
M3D:	small regulatory RNA CyaR

Regulation exerted by the small RNA

Target	Mechanism	Function	Target Type	Binding Site			Evidence Code	Reference(s)
Target	Mechanism	Function	Target Type	LeftPos	RightPos	Sequence	Evidence Code	Reference(s)
ompX	MRNA-DEGRADATION	repressor	TU	850441	850451	GAGGUGGUUAU	[IHBCE] [IMP]	[1] [2]
rpoS	MRNA-DEGRADATION	repressor	TU	2867671	2867685	AAAAUGCAAGCGUGU	[IDA] [IEP] [SM]	[5]
yliM-ompX	MRNA-DEGRADATION	repressor	TU	850441	850451	GAGGUGGUUAU	[IHBCE] [IMP]	[1] [2]
hdeD	TRANSLATION-BLOCKING, MRNA-DEGRADATION	repressor	TU	3656985	3656994	GGGUGGUUCU	[IEP] [IPI] [SM]	[6]
hdeD	TRANSLATION-BLOCKING, MRNA-DEGRADATION	repressor	TU	3656985	3656994	GGGUGGUUCU	[IEP] [IPI] [SM]	[6]
luxS	nd	repressor	TU	2814731	2814745	CAUUUAGCCACCUCC	[IEP] [SM]	[1]
nadE	nd	repressor	TU	1822447	1822460	GGAGGGGUUCAAUG	[GEA] [SM]	[1]
yacL	nd	repressor	TU	nd	nd	nd	[IEP]	[6]
yobF	nd	repressor	Gene	1907574	1907616	ACUGAAAAUGCCACACAUAAACAGAACUGUACCUCGUUUAACC	[IEP] [SM]	[7]
yqaE	nd	repressor	TU	2797013	2797032	UUCUCCAGAAACCCAUAUGU	[GEA] [SM]	[1]

Evidence:

[IHBCE] Inferred by a human based on computational evidence
[IMP] Inferred from mutant phenotype
[IDA] Inferred from direct assay
[IEP] Inferred from expression pattern
[SM] Site mutation
[IPI] Inferred from physical interaction
[GEA] Gene expression analysis

Reference(s)
[1] De Lay N., Gottesman S., 2009, The Crp-activated small noncoding regulatory RNA CyaR (RyeE) links nutritional status to group behavior., J Bacteriol 191(2):461-76
[2] Johansen J., Eriksen M., Kallipolitis B., Valentin-Hansen P., 2008, Down-regulation of Outer Membrane Proteins by Noncoding RNAs: Unraveling the cAMP-CRP- and sigma(E)-Dependent CyaR-ompX Regulatory Case., J Mol Biol 383(1):1-9
[3] Mihailovic MK., Vazquez-Anderson J., Li Y., Fry V., Vimalathas P., Herrera D., Lease RA., Powell WB., Contreras LM., 2018, High-throughput in vivo mapping of RNA accessible interfaces to identify functional sRNA binding sites., Nat Commun 9(1):4084
[4] Sylwan L., Frumerie C., Haggard-Ljungquist E., 2010, Identification of bases required for P2 integrase core binding and recombination., Virology 404(2):240-5
[5] Kim W., Lee Y., 2020, Mechanism for coordinate regulation of rpoS by sRNA-sRNA interaction in Escherichia coli., RNA Biol 17(2):176-187
[6] Lalaouna D., Prevost K., Laliberte G., Houe V., Masse E., 2018, Contrasting silencing mechanisms of the same target mRNA by two regulatory RNAs in Escherichia coli., Nucleic Acids Res 46(5):2600-2612
[7] Wright PR., Richter AS., Papenfort K., Mann M., Vogel J., Hess WR., Backofen R., Georg J., 2013, Comparative genomics boosts target prediction for bacterial small RNAs., Proc Natl Acad Sci U S A 110(37):E3487-96