RegulonDB RegulonDB 10.9: smallRNA Form
   

small regulatory RNA SdsR small RNA in Escherichia coli K-12 genome


Gene local context to scale (view description)

pphA yebY ryeA sdsR anti-anti-terminator anti-terminator terminator anti-anti-terminator anti-terminator terminator pphAp pphAp sdsRp sdsRp ryeAp ryeAp
small RNA      
Gene name: sdsR    Texpresso search in the literature
Synonym(s): RyeB, SdsR, Tkpe79
Genome position: 1923104 <-- 1923207
Strand: reverse
Sequence: Get ribonucleotide sequence FastaFormat
GC content %:  
50.0
Note(s): SdsR is a small regulatory RNA that was shown to base-pair with a part of the mutS coding region. Deletion of sdsR decreases ampicillin-induced mutagenesis Gutierrez A,2013. tolC Parker A,2016 and yhcB Choi JS,2018 were found to be direct targets of SdsR. RNA-seq analysis of an sdsR promoter mutant identified many potential targets for regulation by SdsR Choi JS,2019.
Overexpression of SdsR decreases biofilm development and swarming motility Bak G,2015. Parker A,2016 and translation of TolC, and increases sensitivity to crystal violet and novobiocin Parker A,2016. Ectopic expression of SdsR during exponential phase leads to cell filamentation and death. The effect appears to be mediated by downregulation of YhcB expression; coexpression of RyeA suppresses the effect of ectopic SdsR expression Choi JS,2018.
RyeA/SraC and SdsR are two small RNAs encoded in opposite directions within the same inter-ORF region of the genome. SdsR is approximately 104 nt in length, and a minor SdsR species of 74 nt has also been detected Wassarman KM,2001. Vogel J,2003. SdsR is complementary to an internal segment of RyeA Vogel J,2003.
SdsR interacts with Hfq Wassarman KM,2001. Choi JS,2018; SdsR levels are decreased in an hfq mutant 31248592.
SdsR is most highly expressed in stationary phase Wassarman KM,2001. Choi JS,2019. 31248592, with a coincident appearance of the shorter ~150 nt form of RyeA, which may be due to interaction with SdsR and subsequent processing by RNase III Vogel J,2003. 22180532. The expression patterns of SdsR and RyeA appear to be reciprocal Choi JS,2018; mutation of the ryeA promoter shifts expression of SdsR to an earlier growth phase Choi JS,2019.
The homologous sRNA in S. enterica was shown to regulate synthesis of the major porin OmpD 22180532.
Deletion of sdsR has no significant effect on growth Parker A,2016.
Ryx: RNA of unknown function at X position (10 minute) in the genome Wassarman KM,2001
SdsR (in S. enterica): sigma S-dependent sRNA 22180532. Gutierrez A,2013
Reviews: Gottesman S,2001. 12654996. 32213244
Evidence: [IMP] Inferred from mutant phenotype
Reference(s): [1] Bak G., et al., 2015
[2] Gupta AK., et al., 2020
[3] Kim T., et al., 2015
[4] Rivas E., et al., 2001
[5] Sridhar J., et al., 2007
External database links:  
ECOCYC:
RYEB-RNA
ECOLIWIKI:
b4433
M3D: small regulatory RNA SdsR


Regulation exerted by the small RNA    
  Target Mechanism Function Target Type Binding Site Evidence
Code
Reference(s)
LeftPos RightPos Sequence
 
nd
repressor
TU
2858477
2858501
CGCUGAAAGUUGGCUUUAAUGCGGU
[6]
 
nd
repressor
Gene
3178082
3178089
GCGCUAAA
[7]
 
nd
repressor
TU
3380205
3380212
UGCGCUAA
[8]
Evidence: [IPI] Inferred from physical interaction
[IEP] Inferred from expression pattern
[SM] Site mutation


Reference(s)    

 [1] Bak G., Lee J., Suk S., Kim D., Young Lee J., Kim KS., Choi BS., Lee Y., 2015, Identification of novel sRNAs involved in biofilm formation, motility, and fimbriae formation in Escherichia coli., Sci Rep 5:15287

 [2] Gupta AK., Siddiqui N., Dutta T., 2020, A novel mechanism of RyeA/SraC induction under acid stress., Biochem Biophys Res Commun 525(2):298-302

 [3] Kim T., Bak G., Lee J., Kim KS., 2015, Systematic analysis of the role of bacterial Hfq-interacting sRNAs in the response to antibiotics., J Antimicrob Chemother 70(6):1659-68

 [4] Rivas E., Klein RJ., Jones TA., Eddy SR., 2001, Computational identification of noncoding RNAs in E. coli by comparative genomics., Curr Biol 11(17):1369-73

 [5] Sridhar J., Rafi ZA., 2007, Identification of novel genomic islands associated with small RNAs., In Silico Biol 7(6):601-11

 [6] Gutierrez A., Laureti L., Crussard S., Abida H., Rodriguez-Rojas A., Blazquez J., Baharoglu Z., Mazel D., Darfeuille F., Vogel J., Matic I., 2013, β-Lactam antibiotics promote bacterial mutagenesis via an RpoS-mediated reduction in replication fidelity., Nat Commun 4:1610

 [7] Parker A., Gottesman S., 2016, Small RNA Regulation of TolC, the Outer Membrane Component of Bacterial Multidrug Transporters., J Bacteriol 198(7):1101-13

 [8] Choi JS., Kim W., Suk S., Park H., Bak G., Yoon J., Lee Y., 2018, The small RNA, SdsR, acts as a novel type of toxin in Escherichia coli., RNA Biol 15(10):1319-1335


RegulonDB