RegulonDB RegulonDB 11.1: smallRNA Form
   

small regulatory RNA ChiX small RNA in Escherichia coli K-12 genome


Gene local context to scale (view description)

ybaP ybaK ybaQ chiX ybaPp6 ybaPp6 ybaPp4 ybaPp4 ybaPp3 ybaPp3 ybaQp ybaQp ybaQp3 ybaQp3 TSS_649 TSS_649 TSS_648 TSS_648 TSS_647 TSS_647 TSS_646 TSS_646 chiXp chiXp
small RNA      
Gene name: chiX    Texpresso search in the literature
Synonym(s): ChiX, MicM, RybC, SroB
Genome position: 507204 --> 507287
Strand: forward
Sequence: Get ribonucleotide sequence FastaFormat
GC content %:  
 36.9
Note(s): ChiX is a small RNA that negatively regulates expression of the DpiA/DpiB two-component system Mandin P,2009 and the chitobiose outer membrane porin ChiP (YbfM) Rasmussen AA,2009 by binding to the 5' UTR of both mRNAs. Regulation of ChiP expression was shown to require Hfq Rasmussen AA,2009. Hfq and ChiX interact Zhang A,2003, and Hfq may stabilize ChiX Mandin P,2009.
ChiX was classified as a Class II small RNA, which accumulate to higher levels in the rim mutants and to reduced levels in distal face mutants of Hfq 23318956. 26373314; the C-terminal domain of Hfq contributes to ChiX stability 27681631. ChiX is the most efficient competitor for binding of Hfq among a set of small RNAs. It binds Hfq in a unique way, simultaneously interacting with the opposite faces of the ring-shaped Hfq complex Malecka EM,2015. Binding to the distal site of Hfq via its ARN repeats may contribute to stabilization of ChiX 26373314. Overexpression of ChiX titrates Hfq away from IS10 transposase mRNA, thereby increasing translation of the transposase Ellis MJ, Trussler RS, Haniford DB,2015. ChiX also impacts the function of RyhB by competing for Hfq Chen J,2021.
ChiX itself is regulated by an RNA decoy mechanism: while the ChiX half life does not appear to be influenced by the presence of its target chiP mRNA, interaction of ChiX with the chbB-chbC intergenic region leads to its destabilization Overgaard M,2009. Chen J,2021. Thus, growth of E. coli in chitobiose medium, which induces chbBC expression, results in strongly reduced levels of ChiX and concomitant accumulation of chiP mRNA Overgaard M,2009. chbC expression itself becomes a target of ChiX regulation Plumbridge J,2014.
ChiX is detectable during all growth phases, and its expression is increased in stationary phase Vogel J,2003. Mandin P,2009. ChiX expression is upregulated by low pH under oxygen-limiting conditions Hayes ET,2006. The half life of ChiX is 32 minutes Vogel J,2003. In an hfq mutant, ChiX can not be detected Mandin P,2009.
Overexpression of MicM/ChiX decreases biofilm formation and expression of type I fimbriae and curli Bak G,2015. Mutations in hfq and chiX that lead to overexpression of the ChiP porin compensate for the fitness cost of ompCF deletion 26358402.
SroB: small RNomics RNA Vogel J,2003
RybC: RNA of unknown function at X position (10 minute) in the genome Wassarman KM,2001
Reviews: Vogel J,2009. 19723760. Göpel Y, Görke B,2014. 31249814. 32213244
Evidence: [EXP-IMP] Inferred from mutant phenotype
Reference(s): [1] Kiselev S., et al., 2021
[2] Mandin P., et al., 2009
[3] Mihailovic MK., et al., 2018
[4] Rasmussen AA., et al., 2009
External database links:  
ECOCYC:
 RNA0-123
ECOLIWIKI:
 b4585
M3D: small regulatory RNA ChiX


Regulation exerted by the small RNA    
  Target Mechanism Function Target Type Binding Site Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Sequence
 
TRANSLATION-BLOCKING, MRNA-DEGRADATION
repressor
TU
708315
708326
CGUCAAAGAGGA
S
 
nd
repressor
Gene
1821263
1821283
AUGAAAUAACUCUUUGACGGG
W
 
nd
repressor
TU
652198
652209
CCGUCAAAGAGG
S
[2]
Evidence: [EXP-IMP-SITE-MUTATION] Site mutation
[EXP-IEP] Inferred from expression pattern
[EXP-IGI] Inferred from genetic interaction


Reference(s)    

 [1] Kiselev S., Markelova N., Masulis I., 2021, Divergently Transcribed ncRNAs in Escherichia coli: Refinement of the Transcription Starts Assumes Functional Diversification., Front Mol Biosci 8:610453

 [2] Mandin P., Gottesman S., 2009, A genetic approach for finding small RNAs regulators of genes of interest identifies RybC as regulating the DpiA/DpiB two-component system., Mol Microbiol 72(3):551-65

 [3] Mihailovic MK., Vazquez-Anderson J., Li Y., Fry V., Vimalathas P., Herrera D., Lease RA., Powell WB., Contreras LM., 2018, High-throughput in vivo mapping of RNA accessible interfaces to identify functional sRNA binding sites., Nat Commun 9(1):4084

 [4] Rasmussen AA., Johansen J., Nielsen JS., Overgaard M., Kallipolitis B., Valentin-Hansen P., 2009, A conserved small RNA promotes silencing of the outer membrane protein YbfM., Mol Microbiol 72(3):566-77

 [5] Chen J., To L., de Mets F., Luo X., Majdalani N., Tai CH., Gottesman S., 2021, A fluorescence-based genetic screen reveals diverse mechanisms silencing small RNA signaling in E. coli., Proc Natl Acad Sci U S A 118(27)

 [6] Overgaard M., Johansen J., Moller-Jensen J., Valentin-Hansen P., 2009, Switching off small RNA regulation with trap-mRNA., Mol Microbiol 73(5):790-800

 [7] Plumbridge J., Bossi L., Oberto J., Wade JT., Figueroa-Bossi N., 2014, Interplay of transcriptional and small RNA-dependent control mechanisms regulates chitosugar uptake in Escherichia coli and Salmonella., Mol Microbiol 92(4):648-58

RegulonDB