RegulonDB RegulonDB 10.9: smallRNA Form
   

small regulatory RNA SgrS small RNA in Escherichia coli K-12 genome


Gene local context to scale (view description)

sgrR setA sgrS sgrT SgrR Cra DksA DksA ppGpp ppGpp terminator anti-terminator anti-anti-terminator sgrSp sgrSp sgrRp sgrRp
small RNA      
Gene name: sgrS    Texpresso search in the literature
Synonym(s): RyaA, SgrS
Genome position: 77367 --> 77593
Strand: forward
Sequence: Get ribonucleotide sequence FastaFormat
GC content %:  
47.58
Note(s): The small RNA SgrS post-transcriptionally regulates abundance of |FRAME: PTSG-MONOMER PtsG|, the major glucose transporter. Expression of SgrS is sufficient to inhibit translation and cause loss of ptsG mRNA, and thus loss of the glucose-specific phosphoenolpyruvate phosphotransferase system (PTS), which enables transport of glucose into the cytoplasm and its concurrent phosphorylation to glucose-6-phosphate Vanderpool CK,2004. The secondary glucose transporter ManXYZ was also identified as a target of SgrS regulation Rice JB,2011. Two SgrS binding sites, one in the manX ORF and one in the manX-manY intergenic region, are involved in independent translational repression of the manX and manYZ gene products Rice JB,2012. A third target, whose translation is positively regulated, is the sugar phosphatase YigL Sun Y,2013. SgrS regulation of different subsets of its targets was shown to be required to cope with different stress conditions Sun Y,2013. Additional regulatory targets of SgrS, asd, adiY, folE and purR, aid recovery from glucose-phosphate stress Bobrovskyy M,2016.
The binding of SgrS to its mRNA targets in vivo is dynamic and reversible. Formation of SgrS-mRNA complexes is rate-limiting and determines the overall regulation efficiency of each individual target 25792329. The stability of the sRNA-mRNA duplexes, the relative location of the base pairing sites, and the mode of Hfq binding influence the regulatory hierarchy Bobrovskyy M,2019.
SgrS is part of the response to glucose-phosphate stress. Recent evidence suggests that the metabolic root of this stress is the depletion of glycolytic intermediates 23995640.
SgrS inhibits translation of ptsG mRNA both directly and indirectly. A 14 nucleotide base-pairing region at the 3' end of SgrS is necessary and sufficient for binding to the Shine-Dalgarno region of ptsG mRNA 20345651, forming a stable duplex. Six critical nucleotides in the Shine-Dalgarno region of ptsG are particularly important for this binding, as is the action of Hfq Kawamoto H,2006. Urban JH,2007. Base pairing of SgrS with ptsG mRNA is necessary and sufficient for translational silencing; the role of Hfq is to stimulate duplex formation 18650387, possibly by influencing a negative interaction of SgrS 20345651. The destabilization of ptsG mRNA by SgrS depends on Hfq Kawamoto H,2005. 16166379, likely due to Hfq's ability to recruit RNase E 16166379. 16549791. The polyU tail and a hairpin region of SgrS are required for interaction with Hfq and for the Hfq-dependent regulatory function 21788484. 22454537; the minimal Hfq-binding module has been defined 22454537. SgrS regulation is dependent on the localization of the ptsG mRNA to the inner membrane and insertion of the nascent PtsG peptide into the membrane Kawamoto H,2005.
SgrS was found to regulate the translation of manX by facilitating the interaction of Hfq with a site near the ribosome binding site, which then inhibits initiation of translation Azam MS,2018. Repression of manY translation by SgrS is due to interfering with binding of ribosomal protein S1 to a translation enhancer within the 5' UTR of the manY mRNA Azam MS,2020. Activation of yigL expression by SgrS appears to be due to blocking RNase E from scanning past the SgrS-yigL mRNA duplex for its cleavage site Richards J,2019.
The 5' end of SgrS contains a 43 amino acid open reading frame, |FRAME: G0-10617|, which is translated under conditions of glucose-phosphate stress and regulates the activity of PtsG Wadler CS,2007.
Synthesis of SgrS is induced by the non-metabolizable glucose PTS substrate α-methyl glucoside (α-MG) via the transcriptional regulator SgrR ...
Evidence: [IDA] Inferred from direct assay
[IE] Inferred from experiment
[IMP] Inferred from mutant phenotype
Reference(s): [1] Azam MS., et al., 2020
[2] Kawamoto H., et al., 2005
[3] King AM., et al., 2019
[4] Lloyd CR., et al., 2017
[5] Malecka EM., et al., 2015
[6] Mihailovic MK., et al., 2018
[7] Negrete A., et al., 2017
[8] Sheng H., et al., 2017
[9] Sun Y., et al., 2013
[10] Vanderpool CK., et al., 2004
External database links:  
ECOCYC:
RNA0-241
ECOLIWIKI:
b4577
M3D: small regulatory RNA SgrS


Regulation exerted by the small RNA    
  Target Mechanism Function Target Type Binding Site Evidence
Code
Reference(s)
LeftPos RightPos Sequence
 
asd
MRNA-DEGRADATION
repressor
TU
3574812
3574830
CAACCAUGCGUUGCAUGAG
 
asd
MRNA-DEGRADATION
repressor
TU
3574891
3574909
CCUGCAAAGAUGUGUGCUG
 
MRNA-DEGRADATION
activator
Gene
4010104
4010124
ACGCAAUGCGCUCAGUCGCGC
 
TRANSLATION-BLOCKING
repressor
Gene
1902071
1902084
CACACAUGGUUGGG
 
TRANSLATION-BLOCKING
repressor
TU
1737892
1737910
ACUGUGUCACACGUGAUCA
 
TRANSLATION-BLOCKING, MRNA-DEGRADATION
repressor
TU
4337931
4337945
CAUGUACUCCUGAGU
 
TRANSLATION-BLOCKING, MRNA-DEGRADATION
repressor
TU
2243664
2243677
CCUGCAGGUGUGAC
 
TRANSLATION-BLOCKING, MRNA-DEGRADATION
repressor
TU
1903038
1903052
ACUCAGUUUUCACAC
 
TRANSLATION-BLOCKING, MRNA-DEGRADATION
repressor
TU
1157841
1157872
GCACCCAUACUCAGGAGCACUCUCAAUUAUGU
 
TRANSLATION-BLOCKING, MRNA-DEGRADATION
repressor
TU
1157841
1157872
GCACCCAUACUCAGGAGCACUCUCAAUUAUGU
Evidence: [IPI] Inferred from physical interaction
[IMP] Inferred from mutant phenotype
[SM] Site mutation
[IEP] Inferred from expression pattern
[GEA] Gene expression analysis
[IDA] Inferred from direct assay


Reference(s)    

 [1] Azam MS., Vanderpool CK., 2020, Translation inhibition from a distance: The small RNA SgrS silences a ribosomal protein S1-dependent enhancer., Mol Microbiol

 [2] Kawamoto H., Morita T., Shimizu A., Inada T., Aiba H., 2005, Implication of membrane localization of target mRNA in the action of a small RNA: mechanism of post-transcriptional regulation of glucose transporter in Escherichia coli., Genes Dev 19(3):328-38

 [3] King AM., Vanderpool CK., Degnan PH., 2019, sRNA Target Prediction Organizing Tool (SPOT) Integrates Computational and Experimental Data To Facilitate Functional Characterization of Bacterial Small RNAs., mSphere 4(1)

 [4] Lloyd CR., Park S., Fei J., Vanderpool CK., 2017, The Small Protein SgrT Controls Transport Activity of the Glucose-Specific Phosphotransferase System., J Bacteriol 199(11)

 [5] Malecka EM., Strozecka J., Sobanska D., Olejniczak M., 2015, Structure of bacterial regulatory RNAs determines their performance in competition for the chaperone protein Hfq., Biochemistry 54(5):1157-70

 [6] Mihailovic MK., Vazquez-Anderson J., Li Y., Fry V., Vimalathas P., Herrera D., Lease RA., Powell WB., Contreras LM., 2018, High-throughput in vivo mapping of RNA accessible interfaces to identify functional sRNA binding sites., Nat Commun 9(1):4084

 [7] Negrete A., Shiloach J., 2017, Improving E. coli growth performance by manipulating small RNA expression., Microb Cell Fact 16(1):198

 [8] Sheng H., Stauffer WT., Hussein R., Lin C., Lim HN., 2017, Nucleoid and cytoplasmic localization of small RNAs in Escherichia coli., Nucleic Acids Res 45(5):2919-2934

 [9] Sun Y., Vanderpool CK., 2013, Physiological consequences of multiple-target regulation by the small RNA SgrS in Escherichia coli., J Bacteriol 195(21):4804-15

 [10] Vanderpool CK., Gottesman S., 2004, Involvement of a novel transcriptional activator and small RNA in post-transcriptional regulation of the glucose phosphoenolpyruvate phosphotransferase system., Mol Microbiol 54(4):1076-89

 [11] Bobrovskyy M., Azam MS., Frandsen JK., Zhang J., Poddar A., Ma X., Henkin TM., Ha T., Vanderpool CK., 2019, Determinants of target prioritization and regulatory hierarchy for the bacterial small RNA SgrS., Mol Microbiol 112(4):1199-1218

 [12] Bobrovskyy M., Vanderpool CK., 2016, Diverse mechanisms of post-transcriptional repression by the small RNA regulator of glucose-phosphate stress., Mol Microbiol 99(2):254-73

 [13] Richards J., Belasco JG., 2019, Obstacles to Scanning by RNase E Govern Bacterial mRNA Lifetimes by Hindering Access to Distal Cleavage Sites., Mol Cell 74(2):284-295.e5

 [14] Azam MS., Vanderpool CK., 2018, Translational regulation by bacterial small RNAs via an unusual Hfq-dependent mechanism., Nucleic Acids Res 46(5):2585-2599

 [15] Rice JB., Balasubramanian D., Vanderpool CK., 2012, Small RNA binding-site multiplicity involved in translational regulation of a polycistronic mRNA., Proc Natl Acad Sci U S A 109(40):E2691-8

 [16] Rice JB., Vanderpool CK., 2011, The small RNA SgrS controls sugar-phosphate accumulation by regulating multiple PTS genes., Nucleic Acids Res 39(9):3806-19

 [17] Kawamoto H., Koide Y., Morita T., Aiba H., 2006, Base-pairing requirement for RNA silencing by a bacterial small RNA and acceleration of duplex formation by Hfq., Mol Microbiol 61(4):1013-22


RegulonDB