RegulonDB RegulonDB 11.1: smallRNA Form
   

small regulatory RNA RseX small RNA in Escherichia coli K-12 genome


Gene local context to scale (view description)

yedS hchA drpB rseX terminator hchAp1 hchAp1 hchAp2 hchAp2 TSS_2278 TSS_2278 rseXp rseXp TSS_2277 TSS_2277 yedJp4 yedJp4 yedJp3 yedJp3
small RNA      
Gene name: rseX    Texpresso search in the literature
Synonym(s): RseX
Genome position: 2033649 --> 2033739
Strand: forward
Sequence: Get ribonucleotide sequence FastaFormat
GC content %:  
35.16
Note(s): The small RNA RseX targets the ompA and ompC mRNAs and reduces their levels in the cell. The
RNA-binding protein Hfq binds to RseX and is required for the activity of RseX Douchin V,2006. Additional potential regulatory targets of RseX were predicted, and regulation of fimB and ihfB was confirmed eperimentally Mihailovic MK,2021.
RseX was identified as a mulitcopy suppressor that enables survival of depletion of the essential RIP protease RseP. In the absence of both OmpA and OmpC, the targets of RseX, RseP is not essential for survival. RseX also acts as a suppressor of a degS mutation, but it does not restore σE activity Douchin V,2006.
Overexpression of RseX increases biofilm formation and decreases swarming motility and curli expression Bak G,2015. The existence of RseX was predicted computationally, but IS096 could not be detected by Northern analysis Chen S,2002. RseX is expressed in a Δhns mutant beginning at the transition to stationary phase Mihailovic MK,2021.
RseX: RNA suppressor of extracytoplasmic stress protease Douchin V,2006
Reviews: Vogel J, Papenfort K,2006. De la Cruz MA,2010. 32213244
Evidence: [EXP-IDA] Inferred from direct assay
Reference(s): [1] Douchin V., et al., 2006
[2] Kim T., et al., 2015
[3] Mihailovic MK., et al., 2021
[4] Mihailovic MK., et al., 2018
External database links:  
ECOCYC:
RNA0-327
ECOLIWIKI:
b4603
M3D: small regulatory RNA RseX


Regulation exerted by the small RNA    
  Target Mechanism Function Target Type Binding Site Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Sequence
 
MRNA-DEGRADATION
repressor
TU
1020061
1020075
GCCUCGUUAUCAUCC
W
[1]
 
MRNA-DEGRADATION
repressor
TU
1020061
1020075
GCCUCGUUAUCAUCC
W
[1]
 
MRNA-DEGRADATION
repressor
TU
2312750
2312780
GUUAUUAACCCUCUGUUAUAUGCCUUUAUUU
W
[1]
 
MRNA-DEGRADATION
repressor
TU
2312750
2312780
GUUAUUAACCCUCUGUUAUAUGCCUUUAUUU
W
[1]
 
MRNA-DEGRADATION
repressor
TU
2312750
2312780
GUUAUUAACCCUCUGUUAUAUGCCUUUAUUU
W
[1]
 
nd
repressor
Gene
4540942
4541009
UAUAAGGGAAAAACGAUGAAGAAUAAGGCUGAUAACAAAAAAAGGAACUUCCUGACCCAUAGUGAAAU
S
[3]
 
nd
repressor
Gene
963818
963852
CGGAGGAAUCAUGACCAAGUCAGAAUUGAUAGAAA
S
[3]
Evidence: [EXP-IEP] Inferred from expression pattern
[EXP-IMP] Inferred from mutant phenotype
[EXP-IMP-SITE-MUTATION] Site mutation


Reference(s)    

 [1] Douchin V., Bohn C., Bouloc P., 2006, Down-regulation of porins by a small RNA bypasses the essentiality of the regulated intramembrane proteolysis protease RseP in Escherichia coli., J Biol Chem 281(18):12253-9

 [2] Kim T., Bak G., Lee J., Kim KS., 2015, Systematic analysis of the role of bacterial Hfq-interacting sRNAs in the response to antibiotics., J Antimicrob Chemother 70(6):1659-68

 [3] Mihailovic MK., Ekdahl AM., Chen A., Leistra AN., Li B., Gonzalez Martinez J., Law M., Ejindu C., Masse E., Freddolino PL., Contreras LM., 2021, Uncovering Transcriptional Regulators and Targets of sRNAs Using an Integrative Data-Mining Approach: H-NS-Regulated RseX as a Case Study., Front Cell Infect Microbiol 11:696533

 [4] Mihailovic MK., Vazquez-Anderson J., Li Y., Fry V., Vimalathas P., Herrera D., Lease RA., Powell WB., Contreras LM., 2018, High-throughput in vivo mapping of RNA accessible interfaces to identify functional sRNA binding sites., Nat Commun 9(1):4084


RegulonDB