RegulonDB RegulonDB 10.9: smallRNA Form
   

small regulatory RNA RydC small RNA in Escherichia coli K-12 genome


Gene local context to scale (view description)

cybB ydcA rydC ydcAp7 ydcAp7 ydcAp6 ydcAp6 rydCp rydCp
small RNA      
Gene name: rydC    Texpresso search in the literature
Synonym(s): RydC
Genome position: 1491442 <-- 1491506
Strand: reverse
Sequence: Get ribonucleotide sequence FastaFormat
GC content %:  
49.23
Note(s): RydC is a putative small RNA regulator of the expression of yejABEF, which encodes a predicted ABC permease Antal M,2005, and of the transcriptional regulator CsgD Bordeau V,2014. However, these targets did not show differential regulation in response to RydC overexpression in later experiments King AM,2019. RydC activates the expression of Cfa, promoting survival during acid shock King AM,2019. Bianco CM,2019. Additional regulatory targets of RydC, encoding genes in aromatic amino acid biosynthesis pathways, have been identified King AM,2019.
Hfq binds to RydC in vivo Zhang A,2003 and stabilizes it in vitro Antal M,2005. RydC folds into a pseudoknot structure Zhang A,2003; Hfq facilitates unfolding of the pseudoknot and thereby enhances the interaction of RydC with its mRNA target Bordeau V,2014. A crystal structure of the Salmonella RydC with E. coli Hfq has been solved 25551292. The yejABEF mRNA was found to bind the RydC-Hfq complex Antal M,2005.
A rydC deletion strain has no detectable growth defect, but overexpression of RydC leads to a temperature-sensitive growth defect on minimal medium with glycerol, maltose, or ribose as the carbon source and leads to degradation of yejABEF mRNA Antal M,2005. Overexpression of RydC decreases swarming motility and expression of curli Bak G,2015.
RydC: RNA of unknown function at X position (10 minute) in the genome
Reviews: 25028968. 32213244
Evidence: [IMP] Inferred from mutant phenotype
Reference(s): [1] Antal M., et al., 2005
[2] Bianco CM., et al., 2019
[3] King AM., et al., 2019
External database links:  
ECOCYC:
RNA0-328
ECOLIWIKI:
b4597
M3D: small regulatory RNA RydC


Regulation exerted by the small RNA    
  Target Mechanism Function Target Type Binding Site Evidence
Code
Reference(s)
LeftPos RightPos Sequence
 
cfa
MRNA-DEGRADATION
activator
TU
1741304
1741314
UCUACGUCGGA
 
cfa
MRNA-DEGRADATION
activator
TU
1741304
1741314
UCUACGUCGGA
 
TRANSLATION-BLOCKING
repressor
TU
1103194
1103215
CAUGAUGAAACCCCGCUUUUUU
[4]
 
TRANSLATION-BLOCKING
repressor
TU
1103194
1103215
CAUGAUGAAACCCCGCUUUUUU
[4]
 
nd
repressor
Gene
2737748
2737755
ACAUCGGA
[3]
 
nd
activator
Gene
1322925
1322935
GAGUCGGUUUU
[3]
Evidence: [ICA] Inferred by computational analysis
[IEP] Inferred from expression pattern
[IPI] Inferred from physical interaction
[SM] Site mutation
[IMP] Inferred from mutant phenotype


Reference(s)    

 [1] Antal M., Bordeau V., Douchin V., Felden B., 2005, A small bacterial RNA regulates a putative ABC transporter., J Biol Chem 280(9):7901-8

 [2] Bianco CM., Frohlich KS., Vanderpool CK., 2019, Bacterial Cyclopropane Fatty Acid Synthase mRNA Is Targeted by Activating and Repressing Small RNAs., J Bacteriol 201(19)

 [3] King AM., Vanderpool CK., Degnan PH., 2019, sRNA Target Prediction Organizing Tool (SPOT) Integrates Computational and Experimental Data To Facilitate Functional Characterization of Bacterial Small RNAs., mSphere 4(1)

 [4] Bordeau V., Felden B., 2014, Curli synthesis and biofilm formation in enteric bacteria are controlled by a dynamic small RNA module made up of a pseudoknot assisted by an RNA chaperone., Nucleic Acids Res 42(7):4682-96


RegulonDB