RegulonDB RegulonDB 10.9: smallRNA Form
   

small regulatory RNA FnrS small RNA in Escherichia coli K-12 genome


Gene local context to scale (view description)

zntB ynaL fnrS FNR dbpAp2 dbpAp2 TSS_1769 TSS_1769 TSS_1768 TSS_1768 fnrSp fnrSp
small RNA      
Gene name: fnrS    Texpresso search in the literature
Synonym(s): FnrS
Genome position: 1409129 --> 1409250
Strand: forward
Sequence: Get ribonucleotide sequence FastaFormat
GC content %:  
44.26
Note(s): FnrS is a small regulatory RNA that reprograms metabolism in response to anaerobiosis. Potential regulatory targets were identified by gene expression analysis and proteomic profiling, and selected targets were validated Durand S,2010. Boysen A,2010. Additional targets of FnrS have been identified by comparative genomics Wright PR,2013.
Hfq interacts with and stabilizes FnrS; in an hfq mutant strain, the half life of FnrS is decreased 15-fold from 100 minutes in the wild-type background Boysen A,2010.
Expression of FnrS is occurs only under anaerobic growth conditions and is dependent on FNR Durand S,2010. Boysen A,2010 and affected by ArcA and CRP Durand S,2010. When the existence of FnrS (RydA) was first proposed, no expression could be detected on Northern blots Wassarman KM,2001.
FnrS: FNR-regulated sRNA Boysen A,2010
Review: 32213244
Evidence: [IDA] Inferred from direct assay
[IMP] Inferred from mutant phenotype
Reference(s): [1] Boysen A., et al., 2010
[2] Durand S., et al., 2010
External database links:  
ECOCYC:
RNA0-349
M3D: small regulatory RNA FnrS


Regulation exerted by the small RNA    
  Target Mechanism Function Target Type Binding Site Evidence
Code
Reference(s)
LeftPos RightPos Sequence
 
nd
repressor
TU
nd
nd
nd
[1]
 
nd
repressor
TU
2243667
2243679
GCAGGUGUGACGC
[2]
 
nd
repressor
TU
2421301
2421323
AAGUAAAACAACGGAGAACCUGC
[2]
 
nd
repressor
TU
787592
787608
CCAUAUACUUACUCCUC
[2]
 
nd
repressor
TU
787592
787608
CCAUAUACUUACUCCUC
[2]
 
nd
repressor
Gene
2662068
2662141
CAGAGUUGAGCGCAACGUCAAGCAUUGCGGUCACGGCAUAGCGCCCUUUAGAUGUCAGUCUCAUGUCUUACUUC
[3]
 
nd
repressor
TU
1555660
1555690
UUGGUUCCAUGUCACUCACUCUUUUUUGAAU
[2]
 
nd
repressor
Gene
1619556
1619612
CAAAAAAGAGGUAUGACGAUGUCCAGACGCAAUACUGACGCUAUUACCAUUCAUAGC
[3]
 
nd
repressor
TU
4013035
4013065
UAAUUAGAGGAAGAAAAAAUGACAAUAUUGA
[1]
 
nd
repressor
TU
4100791
4100825
GACAAUACUGGAGAUGAAUAUGAGCUAUACCCUGC
[1]
 
nd
repressor
TU
1735340
1735397
AUUGUACGUAUGCAAAUUAAUAAUAAAGGAGAGUAGCAAUGUCAUUCGAAUUACCUGC
 
nd
repressor
TU
1924952
1924986
GCGUGCAGUUGAAGCCAUAUUAUCUAUUCCUUUUU
[1]
Evidence: [IEP] Inferred from expression pattern
[IMP] Inferred from mutant phenotype
[SM] Site mutation
[IDA] Inferred from direct assay


Reference(s)    

 [1] Boysen A., Moller-Jensen J., Kallipolitis B., Valentin-Hansen P., Overgaard M., 2010, Translational regulation of gene expression by an anaerobically induced small non-coding RNA in Escherichia coli., J Biol Chem 285(14):10690-702

 [2] Durand S., Storz G., 2010, Reprogramming of anaerobic metabolism by the FnrS small RNA., Mol Microbiol 75(5):1215-31

 [3] Wright PR., Richter AS., Papenfort K., Mann M., Vogel J., Hess WR., Backofen R., Georg J., 2013, Comparative genomics boosts target prediction for bacterial small RNAs., Proc Natl Acad Sci U S A 110(37):E3487-96


RegulonDB